rs1358834036

Variant names:

• chr16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G
• rs1358834036
• NM_000548.5:c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP6

The NM_000548.5(TSC2):​c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,018 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: TSC2 NM_000548.5 splice_region, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 2.62
• Publications: 0 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP6: Variant 16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G is Benign according to our data. Variant chr16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 467844.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	NM_000548.5	MANE Select	c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region intron	N/A	NP_000539.2	P49815-1
	TSC2	NM_001406663.1		c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region intron	N/A	NP_001393592.1	A0A2R8Y6C9
	TSC2	NM_001114382.3		c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region intron	N/A	NP_001107854.1	P49815-4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	ENST00000219476.9	TSL:5 MANE Select	c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region intron	N/A	ENSP00000219476.3	P49815-1
	TSC2	ENST00000350773.9	TSL:1	c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region intron	N/A	ENSP00000344383.4	P49815-4
	TSC2	ENST00000401874.7	TSL:1	c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region intron	N/A	ENSP00000384468.2	P49815-5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461018 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726768

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33474

American (AMR) AF: 0.00 AC: 0 AN: 44714

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39694

South Asian (SAS) AF: 0.00 AC: 0 AN: 86242

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52738

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5716

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1111938

Other (OTH) AF: 0.00 AC: 0 AN: 60366

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.0000000568638), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000151

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	-	1	not provided (1)
-	-	1	TSC2-related disorder (1)
-	-	1	Tuberous sclerosis 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1358834036; hg19: chr16-2110818;