rs1358834036

Variant names:

• chr16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G
• rs1358834036
• NM_000548.5:c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP6

The NM_000548.5(TSC2):​c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,018 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: TSC2 NM_000548.5 splice_region, intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:1 B:3
• Conservation: PhyloP100: 2.62

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G is Benign according to our data. Variant chr16-2060817-GGGTGGGGGCAGGAGCTCCGGGGA-G is described in ClinVar as [Conflicting_classifications_of_pathogenicity]. Clinvar id is 467844.We mark this variant Likely_benign, oryginal submissions are: {Likely_benign=2, Uncertain_significance=1}.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TSC2	NM_000548.5	c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region_variant, intron_variant	Intron 11 of 41	ENST00000219476.9	NP_000539.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TSC2	ENST00000219476.9	c.1119+6_1119+28delGTGGGGGCAGGAGCTCCGGGGAG		splice_region_variant, intron_variant	Intron 11 of 41	5	NM_000548.5	ENSP00000219476.3

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461018 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726768

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

Bravo AF: 0.0000151

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:1 Benign:3

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1

Feb 17, 2022

Sema4, Sema4

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: curation

- -

Tuberous sclerosis 2 Benign:1

Dec 04, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

TSC2-related disorder Benign:1

Oct 25, 2022

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

not provided Benign:1

Dec 19, 2023

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

See Variant Classification Assertion Criteria. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1358834036; hg19: chr16-2110818;