16-2091481-ACGCTGAGGGCGGCCAGGGCGCGGCCGGC-A
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_001009944.3(PKD1):c.11626_11653delGCCGGCCGCGCCCTGGCCGCCCTCAGCG(p.Ala3876fs) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 33)
Consequence
PKD1
NM_001009944.3 frameshift
NM_001009944.3 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 5.90
Genes affected
PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 16-2091481-ACGCTGAGGGCGGCCAGGGCGCGGCCGGC-A is Pathogenic according to our data. Variant chr16-2091481-ACGCTGAGGGCGGCCAGGGCGCGGCCGGC-A is described in ClinVar as [Pathogenic]. Clinvar id is 3213430.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PKD1 | NM_001009944.3 | c.11626_11653delGCCGGCCGCGCCCTGGCCGCCCTCAGCG | p.Ala3876fs | frameshift_variant | 42/46 | ENST00000262304.9 | NP_001009944.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PKD1 | ENST00000262304.9 | c.11626_11653delGCCGGCCGCGCCCTGGCCGCCCTCAGCG | p.Ala3876fs | frameshift_variant | 42/46 | 1 | NM_001009944.3 | ENSP00000262304.4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Inborn genetic diseases Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Jan 03, 2024 | The c.11623_11650del28 (p.A3875Sfs*60) alteration, located in exon 42 (coding exon 42) of the PKD1 gene, consists of a deletion of 28 nucleotides from position 11623 to 11650, causing a translational frameshift with a predicted alternate stop codon after 60 amino acids. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. This variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Based on the available evidence, this alteration is classified as pathogenic. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
Publications
No publications associated with this variant yet.