16-23603447-CTTTACCCTAACTTATGAATAG-C

Variant names:

• chr16-23603447-CTTTACCCTAACTTATGAATAG-C
• rs1966393963
• NM_024675.4:c.3552_*11delCTATTCATAAGTTAGGGTAAA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_024675.4(PALB2):​c.3552_*11delCTATTCATAAGTTAGGGTAAA​(p.His1184_Ter1187delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. H1184H) has been classified as Benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PALB2 NM_024675.4 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.29
• Publications: 0 publications found

Genes affected

PALB2 (HGNC:26144): (partner and localizer of BRCA2) This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]

PALB2 Gene-Disease associations (from GenCC):

• hereditary breast carcinoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
• PALB2-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• Fanconi anemia complementation group N

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
• pancreatic cancer, susceptibility to, 3

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• Fanconi anemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_024675.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PALB2	NM_024675.4	MANE Select	c.3552_*11delCTATTCATAAGTTAGGGTAAA	p.His1184_Ter1187delins???	stop_lost conservative_inframe_deletion	Exon 13 of 13	NP_078951.2
	PALB2	NM_024675.4	MANE Select	c.3552_*11delCTATTCATAAGTTAGGGTAAA		3_prime_UTR	Exon 13 of 13	NP_078951.2
	PALB2	NM_001407296.1		c.3492_*11delCTATTCATAAGTTAGGGTAAA	p.His1164_Ter1167delins???	stop_lost conservative_inframe_deletion	Exon 12 of 12	NP_001394225.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PALB2	ENST00000261584.9	TSL:1 MANE Select	c.3552_*11delCTATTCATAAGTTAGGGTAAA	p.His1184_Ter1187delins???	stop_lost conservative_inframe_deletion	Exon 13 of 13	ENSP00000261584.4	Q86YC2
	PALB2	ENST00000568219.5	TSL:1	c.2667_*11delCTATTCATAAGTTAGGGTAAA	p.His889_Ter892delins???	stop_lost conservative_inframe_deletion	Exon 13 of 13	ENSP00000454703.2	H3BN63
	PALB2	ENST00000261584.9	TSL:1 MANE Select	c.3552_*11delCTATTCATAAGTTAGGGTAAA		3_prime_UTR	Exon 13 of 13	ENSP00000261584.4	Q86YC2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	2	-	Hereditary cancer-predisposing syndrome (2)
-	1	-	Familial cancer of breast (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1966393963; hg19: chr16-23614768;