16-23603447-CTTTACCCTAACTTATGAATAG-C

Position:

• chr16-23603447-CTTTACCCTAACTTATGAATAG-C

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_024675.4(PALB2):​c.3552_*11delCTATTCATAAGTTAGGGTAAA​(p.His1184_Ter1187delins???) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PALB2 NM_024675.4 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 1.29

Genes affected

PALB2 (HGNC:26144): (partner and localizer of BRCA2) This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Stoplost variant. No alternative stopcodon identified downstream, so we assume a Nonstop Mediated Decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PALB2	NM_024675.4	c.3552_*11delCTATTCATAAGTTAGGGTAAA	p.His1184_Ter1187delins???	stop_lost, conservative_inframe_deletion	Exon 13 of 13	ENST00000261584.9	NP_078951.2
PALB2	NM_024675.4	c.3551_*11delCTATTCATAAGTTAGGGTAAA		3_prime_UTR_variant	Exon 13 of 13	ENST00000261584.9	NP_078951.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PALB2	ENST00000261584.9	c.3552_*11delCTATTCATAAGTTAGGGTAAA	p.His1184_Ter1187delins???	stop_lost, conservative_inframe_deletion	Exon 13 of 13	1	NM_024675.4	ENSP00000261584.4
PALB2	ENST00000261584	c.3551_*11delCTATTCATAAGTTAGGGTAAA		3_prime_UTR_variant	Exon 13 of 13	1	NM_024675.4	ENSP00000261584.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:2

Uncertain significance, criteria provided, single submitter	clinical testing	Ambry Genetics	Apr 19, 2021	The c.3552_*11del21 variant, located in coding exon 13 of the PALB2 gene, results from a deletion of 21 nucleotides at nucleotide position 3552, causing a translational frameshift with a predicted alternate stop (p.H1184Qfs*2). This alteration occurs at the 3' terminus of thePALB2 gene, is not expected to trigger nonsense-mediated mRNAdecay, and only impacts the last 3 amino acids of the protein. The exact functional effect of this alteration is unknown. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Uncertain significance, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	Dec 23, 2019	This variant deletes 21 nucleotides in exon 13 and 3' untranslated region of the PALB2 gene, causing a deletion of 3 amino acids in the last exon and addition of 1 amino acid before introducing a stop codon. To our knowledge, functional studies have not been performed for this variant. This variant has not been reported in individuals affected with hereditary cancer in the literature. This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Familial cancer of breast Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

May 11, 2024

This variant, c.3552_*11del, is a complex sequence change that results in the deletion of 3 and insertion of 1 amino acid(s) in the PALB2 protein (p.His1184_Ser1186delinsGln). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PALB2-related conditions. ClinVar contains an entry for this variant (Variation ID: 920336). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts the WD40-like repeats of the PALB2 protein, which are required for interactions with the BRCA2, POLH, and RAD51C proteins (PMID: 24141787, 24485656). While functional studies have not been performed to directly test the effect of this variant on PALB2 protein function, this suggests that disruption of this region of the protein is causative of disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1966393963; hg19: chr16-23614768;