16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G

Variant names:

• chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G
• rs1555502431
• NM_145239.3:c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 10P and 2B. PVS1 PM2 BP6_Moderate

The NM_145239.3(PRRT2):​c.-68_-46+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: PRRT2 NM_145239.3 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.69

Genes affected

PRRT2 (HGNC:30500): (proline rich transmembrane protein 2) This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

ENSG00000280893 (HGNC:):

MVP-DT (HGNC:56029): (MVP divergent transcript)

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, Cryptic splice site detected, with MaxEntScore 7.2, offset of -1, new splice context is: cggGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• BP6: Variant 16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is Benign according to our data. Variant chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is described in ClinVar as [Likely_benign]. Clinvar id is 511786.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PRRT2	NM_145239.3	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		splice_region_variant	Exon 1 of 4	ENST00000358758.12	NP_660282.2
PRRT2	NM_145239.3	c.-68_-46+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant	Exon 1 of 4	ENST00000358758.12	NP_660282.2
PRRT2	NM_145239.3	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		non_coding_transcript_variant		ENST00000358758.12	NP_660282.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PRRT2	ENST00000358758	c.-157_-129delAGCTGTCCGGAGGCCGGCGTCGAGGTGAG		5_prime_UTR_variant	Exon 1 of 4	1	NM_145239.3	ENSP00000351608.7

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Benign:1

Sep 12, 2017

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555502431; hg19: chr16-29823619;