rs1555502431

Variant names:

• chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G
• rs1555502431
• NM_145239.3:c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 8P and 2B. PVS1 BP6_Moderate

The NM_145239.3(PRRT2):​c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: PRRT2 NM_145239.3 splice_donor, splice_region, 5_prime_UTR, intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.69
• Publications: 0 publications found

Genes affected

PRRT2 (HGNC:30500): (proline rich transmembrane protein 2) This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

ENSG00000280893 (HGNC:):

MVP-DT (HGNC:56029): (MVP divergent transcript)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, Cryptic splice site detected, with MaxEntScore 7.2, offset of -1, new splice context is: cggGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
• BP6: Variant 16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is Benign according to our data. Variant chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is described in ClinVar as Likely_benign. ClinVar VariationId is 511786.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_145239.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRRT2	NM_145239.3	MANE Select	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		splice_region	Exon 1 of 4	NP_660282.2	Q7Z6L0-1
	PRRT2	NM_145239.3	MANE Select	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		splice_donor splice_region 5_prime_UTR intron	Exon 1 of 4	NP_660282.2	Q7Z6L0-1
	PRRT2	NM_145239.3	MANE Select	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		non_coding_transcript	N/A	NP_660282.2	Q7Z6L0-1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PRRT2	ENST00000358758.12	TSL:1 MANE Select	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		splice_region	Exon 1 of 4	ENSP00000351608.7	Q7Z6L0-1
	PRRT2	ENST00000358758.12	TSL:1 MANE Select	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		splice_donor splice_region 5_prime_UTR intron	Exon 1 of 4	ENSP00000351608.7	Q7Z6L0-1
	PRRT2	ENST00000358758.12	TSL:1 MANE Select	c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA		non_coding_transcript	N/A	ENSP00000351608.7	Q7Z6L0-1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555502431; hg19: chr16-29823619;