chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G
Variant summary
Our verdict is Likely pathogenic. Variant got 8 ACMG points: 10P and 2B. PVS1PM2BP6_Moderate
The ENST00000358758(PRRT2):c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Genomes: not found (cov: 31)
Consequence
PRRT2
ENST00000358758 splice_donor, splice_region, 5_prime_UTR, intron
ENST00000358758 splice_donor, splice_region, 5_prime_UTR, intron
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 1.69
Genes affected
PRRT2 (HGNC:30500): (proline rich transmembrane protein 2) This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 8 ACMG points.
PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, Cryptic splice site detected, with MaxEntScore 7.2, offset of -1, new splice context is: cggGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
BP6
Variant 16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is Benign according to our data. Variant chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is described in ClinVar as [Likely_benign]. Clinvar id is 511786.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
PRRT2 | NM_145239.3 | c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | splice_region_variant | 1/4 | ENST00000358758.12 | NP_660282.2 | ||
PRRT2 | NM_145239.3 | c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | 1/4 | ENST00000358758.12 | NP_660282.2 | ||
PRRT2 | NM_145239.3 | c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | non_coding_transcript_variant | ENST00000358758.12 | NP_660282.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PRRT2 | ENST00000358758.12 | c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | splice_region_variant | 1/4 | 1 | NM_145239.3 | ENSP00000351608.7 | |||
PRRT2 | ENST00000358758 | c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | 1/4 | 1 | NM_145239.3 | ENSP00000351608.7 | |||
PRRT2 | ENST00000358758.12 | c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | non_coding_transcript_variant | 1 | NM_145239.3 | ENSP00000351608.7 | ||||
ENSG00000280893 | ENST00000609618.2 | n.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | splice_region_variant, non_coding_transcript_exon_variant | 1/6 | 5 | ENSP00000476774.2 | ||||
ENSG00000280893 | ENST00000609618.2 | n.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA | splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant | 1/6 | 5 | ENSP00000476774.2 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 31
GnomAD4 genome
Cov.:
31
ClinVar
Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not specified Benign:1
Likely benign, criteria provided, single submitter | clinical testing | GeneDx | Sep 12, 2017 | This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at