chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 10P and 2B. PVS1PM2BP6_Moderate

The ENST00000358758(PRRT2):​c.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA variant causes a splice donor, splice region, 5 prime UTR, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

Frequency

Genomes: not found (cov: 31)

Consequence

PRRT2
ENST00000358758 splice_donor, splice_region, 5_prime_UTR, intron

Scores

Not classified

Clinical Significance

Likely benign criteria provided, single submitter B:1

Conservation

PhyloP100: 1.69
Variant links:
Genes affected
PRRT2 (HGNC:30500): (proline rich transmembrane protein 2) This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, Cryptic splice site detected, with MaxEntScore 7.2, offset of -1, new splice context is: cggGTagga. Cryptic site results in frameshift change. If cryptic site found is not functional and variant results in exon loss, it results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
BP6
Variant 16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is Benign according to our data. Variant chr16-29812298-GGAGCTGTCCGGAGGCCGGCGTCGAGGTGA-G is described in ClinVar as [Likely_benign]. Clinvar id is 511786.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
PRRT2NM_145239.3 linkuse as main transcriptc.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA splice_region_variant 1/4 ENST00000358758.12 NP_660282.2 Q7Z6L0-1
PRRT2NM_145239.3 linkuse as main transcriptc.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant 1/4 ENST00000358758.12 NP_660282.2 Q7Z6L0-1
PRRT2NM_145239.3 linkuse as main transcriptc.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA non_coding_transcript_variant ENST00000358758.12 NP_660282.2 Q7Z6L0-1

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
PRRT2ENST00000358758.12 linkuse as main transcriptc.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA splice_region_variant 1/41 NM_145239.3 ENSP00000351608.7 Q7Z6L0-1
PRRT2ENST00000358758 linkuse as main transcriptc.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant 1/41 NM_145239.3 ENSP00000351608.7 Q7Z6L0-1
PRRT2ENST00000358758.12 linkuse as main transcriptc.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA non_coding_transcript_variant 1 NM_145239.3 ENSP00000351608.7 Q7Z6L0-1
ENSG00000280893ENST00000609618.2 linkuse as main transcriptn.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA splice_region_variant, non_coding_transcript_exon_variant 1/65 ENSP00000476774.2 A0A0G2JLL6
ENSG00000280893ENST00000609618.2 linkuse as main transcriptn.-88_-66+6delGCTGTCCGGAGGCCGGCGTCGAGGTGAGA splice_donor_variant, splice_region_variant, 5_prime_UTR_variant, intron_variant 1/65 ENSP00000476774.2 A0A0G2JLL6

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Benign:1
Likely benign, criteria provided, single submitterclinical testingGeneDxSep 12, 2017This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555502431; hg19: chr16-29823619; API