16-3501075-TCCGCGACCTCCGCAGTAAGGCAGCC-T

Position:

• chr16-3501075-TCCGCGACCTCCGCAGTAAGGCAGCC-T

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_015041.3(CLUAP1):​c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG​(p.Leu6_Asn8del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CLUAP1 NM_015041.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.85

Genes affected

CLUAP1 (HGNC:19009): (clusterin associated protein 1) The protein encoded by this gene contains a single coiled-coil region. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]

ENSG00000263212 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_015041.3.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CLUAP1	NM_015041.3	c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG	p.Leu6_Asn8del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	1/12	ENST00000576634.6	NP_055856.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CLUAP1	ENST00000576634.6	c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG	p.Leu6_Asn8del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	1/12	1	NM_015041.3	ENSP00000460850.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 26, 2019

The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in CLUAP1 cause disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with CLUAP1-related conditions. This variant results in the deletion of part of exon 1 (c.14_22+16del) of the CLUAP1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs2037387066; hg19: chr16-3551075;