chr16-3501075-TCCGCGACCTCCGCAGTAAGGCAGCC-T
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_015041.3(CLUAP1):c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG(p.Leu6_Asn8del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. D5D) has been classified as Likely benign.
Frequency
Consequence
NM_015041.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- Leber congenital amaurosisInheritance: AR Classification: LIMITED Submitted by: Franklin by Genoox
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_015041.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CLUAP1 | MANE Select | c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG | p.Leu6_Asn8del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 1 of 12 | NP_055856.1 | Q96AJ1-1 | ||
| CLUAP1 | c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG | p.Leu6_Asn8del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 1 of 13 | NP_001317383.1 | J3KNW5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CLUAP1 | TSL:1 MANE Select | c.9_22+11delCCGCGACCTCCGCAGTAAGGCAGCC | p.Phe3LeufsTer2 | frameshift splice_donor splice_region intron | Exon 1 of 12 | ENSP00000460850.1 | Q96AJ1-1 | ||
| CLUAP1 | TSL:5 | c.9_22+11delCCGCGACCTCCGCAGTAAGGCAGCC | p.Phe3LeufsTer2 | frameshift splice_donor splice_region intron | Exon 1 of 13 | ENSP00000344392.5 | J3KNW5 | ||
| CLUAP1 | c.9_22+11delCCGCGACCTCCGCAGTAAGGCAGCC | p.Phe3LeufsTer2 | frameshift splice_donor splice_region intron | Exon 1 of 13 | ENSP00000639065.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at