NM_015041.3:c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG

Variant names:

• chr16-3501075-TCCGCGACCTCCGCAGTAAGGCAGCC-T
• rs2037387066
• NM_015041.3:c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_015041.3(CLUAP1):​c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG​(p.Leu6_Asn8del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. D5D) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CLUAP1 NM_015041.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.85
• Publications: 0 publications found

Genes affected

CLUAP1 (HGNC:19009): (clusterin associated protein 1) The protein encoded by this gene contains a single coiled-coil region. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]

CLUAP1 Gene-Disease associations (from GenCC):

• Leber congenital amaurosis

  Inheritance: AR Classification: LIMITED Submitted by: Franklin by Genoox

ENSG00000263212 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_015041.3.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_015041.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLUAP1	NM_015041.3	MANE Select	c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG	p.Leu6_Asn8del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 1 of 12	NP_055856.1	Q96AJ1-1
	CLUAP1	NM_001330454.2		c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG	p.Leu6_Asn8del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 1 of 13	NP_001317383.1	J3KNW5

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CLUAP1	ENST00000576634.6	TSL:1 MANE Select	c.9_22+11delCCGCGACCTCCGCAGTAAGGCAGCC	p.Phe3LeufsTer2	frameshift splice_donor splice_region intron	Exon 1 of 12	ENSP00000460850.1	Q96AJ1-1
	CLUAP1	ENST00000341633.9	TSL:5	c.9_22+11delCCGCGACCTCCGCAGTAAGGCAGCC	p.Phe3LeufsTer2	frameshift splice_donor splice_region intron	Exon 1 of 13	ENSP00000344392.5	J3KNW5
	CLUAP1	ENST00000969006.1		c.9_22+11delCCGCGACCTCCGCAGTAAGGCAGCC	p.Phe3LeufsTer2	frameshift splice_donor splice_region intron	Exon 1 of 13	ENSP00000639065.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs2037387066; hg19: chr16-3551075;