NM_015041.3:c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_015041.3(CLUAP1):c.14_22+16delACCTCCGCAGTAAGGCAGCCCCGCG(p.Leu6_Asn8del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. D5D) has been classified as Likely benign.
Frequency
Consequence
NM_015041.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
not provided Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in CLUAP1 cause disease. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. This variant has not been reported in the literature in individuals with CLUAP1-related conditions. This variant results in the deletion of part of exon 1 (c.14_22+16del) of the CLUAP1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at