16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate

The NM_004380.3(CREBBP):​c.6130_6171delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG​(p.Ala2044_Gln2057del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

CREBBP
NM_004380.3 conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 6.08

Publications

0 publications found
Variant links:
Genes affected
CREBBP (HGNC:2348): (CREB binding protein) This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
CREBBP Gene-Disease associations (from GenCC):
  • Rubinstein-Taybi syndrome
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen, Illumina
  • Rubinstein-Taybi syndrome due to CREBBP mutations
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
  • Menke-Hennekam syndrome 1
    Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_004380.3.
PP5
Variant 16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G is Pathogenic according to our data. Variant chr16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G is described in CliVar as Likely_pathogenic. Clinvar id is 158396.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G is described in CliVar as Likely_pathogenic. Clinvar id is 158396.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G is described in CliVar as Likely_pathogenic. Clinvar id is 158396.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G is described in CliVar as Likely_pathogenic. Clinvar id is 158396.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CREBBPNM_004380.3 linkc.6130_6171delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG p.Ala2044_Gln2057del conservative_inframe_deletion Exon 31 of 31 ENST00000262367.10 NP_004371.2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CREBBPENST00000262367.10 linkc.6130_6171delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG p.Ala2044_Gln2057del conservative_inframe_deletion Exon 31 of 31 1 NM_004380.3 ENSP00000262367.5 Q92793-1
CREBBPENST00000382070.7 linkc.6016_6057delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG p.Ala2006_Gln2019del conservative_inframe_deletion Exon 30 of 30 1 ENSP00000371502.3 Q92793-2

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Rubinstein-Taybi syndrome due to CREBBP mutations Pathogenic:1
Feb 08, 2013
Genetic Services Laboratory, University of Chicago
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
6.1
Mutation Taster
=38/162
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs587783511; hg19: chr16-3778876; API