rs587783511

Variant names:

• chr16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G
• rs587783511
• NM_004380.3:c.6130_6171delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP5_Moderate

The NM_004380.3(CREBBP):​c.6130_6171delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG​(p.Ala2044_Gln2057del) variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CREBBP NM_004380.3 conservative_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.08
• Publications: 0 publications found

Genes affected

CREBBP (HGNC:2348): (CREB binding protein) This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]

CREBBP Gene-Disease associations (from GenCC):

• Rubinstein-Taybi syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen, Illumina
• Rubinstein-Taybi syndrome due to CREBBP mutations

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• Menke-Hennekam syndrome 1

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004380.3.
• PP5: Variant 16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G is Pathogenic according to our data. Variant chr16-3728875-GCTGCACGCTGGGCATCCGGGGCCCAGCCACGGCCGCCTGGGC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 158396.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CREBBP	NM_004380.3	c.6130_6171delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG	p.Ala2044_Gln2057del	conservative_inframe_deletion	Exon 31 of 31	ENST00000262367.10	NP_004371.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CREBBP	ENST00000262367.10	c.6130_6171delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG	p.Ala2044_Gln2057del	conservative_inframe_deletion	Exon 31 of 31	1	NM_004380.3	ENSP00000262367.5
CREBBP	ENST00000382070.7	c.6016_6057delGCCCAGGCGGCCGTGGCTGGGCCCCGGATGCCCAGCGTGCAG	p.Ala2006_Gln2019del	conservative_inframe_deletion	Exon 30 of 30	1		ENSP00000371502.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Rubinstein-Taybi syndrome due to CREBBP mutations Pathogenic:1

Feb 08, 2013

Genetic Services Laboratory, University of Chicago

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.1
Mutation Taster		=38/162	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587783511; hg19: chr16-3778876;