16-67842866-G-GCAGCAGCAACAGCAGCAGCAGCAGCAA

Position:

• chr16-67842866-G-GCAGCAGCAACAGCAGCAGCAGCAGCAA

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_020457.3(THAP11):​c.348_374dupACAGCAGCAGCAGCAGCAACAGCAGCA​(p.Gln117_Gln125dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000132 in 150,986 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: 𝑓 0.00013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000041 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: THAP11 NM_020457.3 disruptive_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.10

Genes affected

THAP11 (HGNC:23194): (THAP domain containing 11) The protein encoded by this gene contains a THAP domain, which is a conserved DNA-binding domain that has striking similarity to the site-specific DNA-binding domain (DBD) of Drosophila P element transposases. [provided by RefSeq, Jul 2008]

CENPT (HGNC:25787): (centromere protein T) The centromere is a specialized chromatin domain, present throughout the cell cycle, that acts as a platform on which the transient assembly of the kinetochore occurs during mitosis. All active centromeres are characterized by the presence of long arrays of nucleosomes in which CENPA (MIM 117139) replaces histone H3 (see MIM 601128). CENPT is an additional factor required for centromere assembly (Foltz et al., 2006 [PubMed 16622419]).[supplied by OMIM, Mar 2008]

CENPT (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_020457.3
• BS2: High AC in GnomAd4 at 20 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
THAP11	NM_020457.3	c.348_374dupACAGCAGCAGCAGCAGCAACAGCAGCA	p.Gln117_Gln125dup	disruptive_inframe_insertion	1/1	ENST00000303596.3	NP_065190.2
CENPT	NM_025082.4	c.-492+4508_-492+4534dupTTGCTGCTGCTGCTGCTGTTGCTGCTG		intron_variant		ENST00000562787.6	NP_079358.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
THAP11	ENST00000303596.3	c.348_374dupACAGCAGCAGCAGCAGCAACAGCAGCA	p.Gln117_Gln125dup	disruptive_inframe_insertion	1/1	6	NM_020457.3	ENSP00000304689.1
CENPT	ENST00000562787.6	c.-492+4508_-492+4534dupTTGCTGCTGCTGCTGCTGTTGCTGCTG		intron_variant		2	NM_025082.4	ENSP00000457810.1

Frequencies

GnomAD3 genomes AF: 0.000126 AC: 19 AN: 150880 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000488

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000779

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000193

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000334 AC: 8 AN: 239300 Hom.: 0 AF XY: 0.0000152 AC XY: 2 AN XY: 131332

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000283

Gnomad SAS exome AF: 0.0000330

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000188

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000412 AC: 60 AN: 1456752 Hom.: 0 Cov.: 31 AF XY: 0.0000469 AC XY: 34 AN XY: 724806

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000278

Gnomad4 SAS exome AF: 0.0000232

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000370

Gnomad4 OTH exome AF: 0.0000333

GnomAD4 genome AF: 0.000132 AC: 20 AN: 150986 Hom.: 0 Cov.: 32 AF XY: 0.000176 AC XY: 13 AN XY: 73804

Gnomad4 AFR AF: 0.0000730

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000780

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000193

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Nov 06, 2023

This variant, c.348_374dup, results in the insertion of 9 amino acid(s) of the THAP11 protein (p.Gln124_Gln132dup), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with THAP11-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs745578392; hg19: chr16-67876769;