16-89919802-TACTACGACCACGTGGCCGTCCTGCTGTGCCTCGTGGTCTTCTTCCTGGCTATGCTGGTGCTCATGGCCGTGCTGTACGTCCACATGCTGGCCCGGGCCTGCCAGCACGCCCAGGGCATCGCCCGGCTCCACAAGAGGCAGCGCCCGGTCCACCAGGGCTTTGGCCTTAAAGGCGCTGTCACCCTCACCATCCTGCTGGGCATTTTCTTCCTCTGCTGGGGCCCCTTCTTCCTGCATCTCACACTCATCGTCCTCTGCCCCGAGCACCCCACGTGCGGCTGCATCTTCAAGAACTTCAACCTCTTTCTCGCCCTCATCATCTGCAATGCCATCATCGACCCCCTCATCTACGCCTTCCACAGCCAGGAGCTCCGCAGGACGCTCAAGGAGGTGCTGACATGCTCCTGGTGAGCGCGGTGCACGCGGCTTTAAGTGTGCTGGGCAGAGGGAGGTGGTGATATTGTGTGGTCTGGTTCCTGTGTGACCCTGGGCAGTTCCTTACCTCCCTGGTCCCCGTTTGTCAAAGAGGATGGACTAAATGATCTCTGAAAGTGTTGAAGCGCGGACCCTTCTGGGTCCAGGGAGGGGTCCCTGCAAAACTCCAGGCAGGACTTCTCACCAGCAGTCGTGGGGAACGGAGGAGGACATGGGGAGGTTGTGGGGCCTCAGGCTCCGGGCACCAGGGGCCAACCTCAGGCTCCTAAAGAGACATTTTCCGCCCACTCCTGGGACACTCCGTCTGCTCCAATGACTGAGCAGCATCCACCCCACCCCATCTTTGCTGCCAGCTCTCAGGACCGTGCCCTCGTCAGCTGGGATGTGAAGTCTCTGGGTGGAAGTGTGTGCCAAGAGCTACTCCCACAGCAGCCCCAGGAGAAGGGGCTTTGTGACCAGAAAGCTTCATCCACAGCCTTGCAGCGGCTCCTGCAAAAGGAGGTGAAATCCCTGCCTCAGGCCAAGGGACCAGGTTTGCAGGAGCCCCCCTAGTGGTATGGGGCTGA-T
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The ENST00000556922.1(ENSG00000198211):c.545_1098+65del variant causes a exon loss change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 33)
Consequence
ENSG00000198211
ENST00000556922.1 exon_loss
ENST00000556922.1 exon_loss
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 4.98
Genes affected
MC1R (HGNC:6929): (melanocortin 1 receptor) This intronless gene encodes the receptor protein for melanocyte-stimulating hormone (MSH). The encoded protein, a seven pass transmembrane G protein coupled receptor, controls melanogenesis. Two types of melanin exist: red pheomelanin and black eumelanin. Gene mutations that lead to a loss in function are associated with increased pheomelanin production, which leads to lighter skin and hair color. Eumelanin is photoprotective but pheomelanin may contribute to UV-induced skin damage by generating free radicals upon UV radiation. Binding of MSH to its receptor activates the receptor and stimulates eumelanin synthesis. This receptor is a major determining factor in sun sensitivity and is a genetic risk factor for melanoma and non-melanoma skin cancer. Over 30 variant alleles have been identified which correlate with skin and hair color, providing evidence that this gene is an important component in determining normal human pigment variation. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 2 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
MC1R | NM_002386.4 | c.545_*590del | p.Tyr182fs | frameshift_variant, stop_lost | 1/1 | ENST00000555147.2 | NP_002377.4 | |
MC1R | NM_002386.4 | c.545_*590del | 3_prime_UTR_variant | 1/1 | ENST00000555147.2 | NP_002377.4 | ||
ENSG00000198211 | n.89919803_89920802del | bidirectional_gene_fusion | ||||||
MC1R | n.89919803_89920802del | bidirectional_gene_fusion |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ENSG00000198211 | ENST00000556922.1 | c.545_1098+65del | exon_loss_variant | 2/5 | 2 | ENSP00000451560.1 | ||||
ENSG00000198211 | ENST00000556922.1 | c.545_1098+65del | p.Tyr182fs | frameshift_variant | 2/5 | 2 | ENSP00000451560.1 | |||
MC1R | ENST00000555147.2 | c.545_*590del | p.Tyr182fs | frameshift_variant, stop_lost | 1/1 | 6 | NM_002386.4 | ENSP00000451605.1 | ||
MC1R | ENST00000555147.2 | c.545_*590del | 3_prime_UTR_variant | 1/1 | 6 | NM_002386.4 | ENSP00000451605.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Melanoma, cutaneous malignant, susceptibility to, 5 Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Nov 19, 2017 | This variant is a gross deletion of the MC1R single exon gene (c.544_*590del), and encompasses ~40% of the coding sequence. While this deletion is not anticipated to result in nonsense mediated decay, it is expected to create a truncated protein product. This variant has not been reported in the literature in individuals with MC1R-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at