17-1650815-TCCTCCCGATCCGCAGAGTAAA-T

Position:

• chr17-1650815-TCCTCCCGATCCGCAGAGTAAA-T

Variant summary

Our verdict is Pathogenic. Variant got 15 ACMG points: 15P and 0B. PM1 PM2 PM4 PP3 PP5_Very_Strong

The NM_006445.4(PRPF8):​c.6974_6994delTTTACTCTGCGGATCGGGAGG​(p.Val2325_Glu2331del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: PRPF8 NM_006445.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 7.75

Genes affected

PRPF8 (HGNC:17340): (pre-mRNA processing factor 8) Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]

PRPF8 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 15 ACMG points.

• PM1: In a region_of_interest Required for interaction with EFTUD2 and SNRNP200 (size 34) in uniprot entity PRP8_HUMAN there are 30 pathogenic changes around while only 0 benign (100%) in NM_006445.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_006445.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 17-1650815-TCCTCCCGATCCGCAGAGTAAA-T is Pathogenic according to our data. Variant chr17-1650815-TCCTCCCGATCCGCAGAGTAAA-T is described in ClinVar as [Pathogenic]. Clinvar id is 916436.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr17-1650815-TCCTCCCGATCCGCAGAGTAAA-T is described in Lovd as [Pathogenic]. Variant chr17-1650815-TCCTCCCGATCCGCAGAGTAAA-T is described in Lovd as [Likely_pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PRPF8	NM_006445.4	c.6974_6994delTTTACTCTGCGGATCGGGAGG	p.Val2325_Glu2331del	disruptive_inframe_deletion	43/43	ENST00000304992.11	NP_006436.3
PRPF8	XM_024450537.2	c.6974_6994delTTTACTCTGCGGATCGGGAGG	p.Val2325_Glu2331del	disruptive_inframe_deletion	43/43		XP_024306305.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PRPF8	ENST00000304992.11	c.6974_6994delTTTACTCTGCGGATCGGGAGG	p.Val2325_Glu2331del	disruptive_inframe_deletion	43/43	1	NM_006445.4	ENSP00000304350.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Nov 01, 2022	For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 916436). This variant has been observed in individual(s) with autosomal dominant retinitis pigmentosa (PMID: 12714658). It has also been observed to segregate with disease in related individuals. This variant is not present in population databases (gnomAD no frequency). This variant, c.6974_6994del, results in the deletion of 7 amino acid(s) of the PRPF8 protein (p.Val2325_Glu2331del), but otherwise preserves the integrity of the reading frame. -
Pathogenic, criteria provided, single submitter	clinical testing	CeGaT Center for Human Genetics Tuebingen	Mar 01, 2020	- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1910994325; hg19: chr17-1554109;