17-28554891-TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG-AGCAACC

Position:

• chr17-28554891-TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG-AGCAACC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PS1 PM2 PM4 PP3 PP5

The NM_033198.4(PIGS):​c.1316_1352delCCACCACCCTTACCTCCCTGGCGCAGCTTCTGGGCAAinsGGTTGCT​(p.Thr439_Lys451delinsArgLeuLeu) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Another nucleotide change resulting in the same amino acid substitution has been previously reported as Pathogenic in Lovd.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PIGS NM_033198.4 missense, disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.95

Genes affected

PIGS (HGNC:14937): (phosphatidylinositol glycan anchor biosynthesis class S) This gene encodes a protein that is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene encodes an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. [provided by RefSeq, Jul 2008]

RSKR (HGNC:26314): (ribosomal protein S6 kinase related) Predicted to enable protein kinase activity. Predicted to be involved in protein phosphorylation. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PS1: Transcript NM_033198.4 (PIGS) is affected with MISSENSE_VARIANT having same AA change as one Pathogenic present in Lovd
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_033198.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 17-28554891-TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG-AGCAACC is Pathogenic according to our data. Variant chr17-28554891-TTGCCCAGAAGCTGCGCCAGGGAGGTAAGGGTGGTGG-AGCAACC is described in ClinVar as [Pathogenic]. Clinvar id is 585255.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
PIGS	NM_033198.4	c.1316_1352delCCACCACCCTTACCTCCCTGGCGCAGCTTCTGGGCAAinsGGTTGCT	p.Thr439_Lys451delinsArgLeuLeu	missense_variant, disruptive_inframe_deletion		ENST00000308360.8	NP_149975.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
PIGS	ENST00000308360.8	c.1316_1352delCCACCACCCTTACCTCCCTGGCGCAGCTTCTGGGCAAinsGGTTGCT	p.Thr439_Lys451delinsArgLeuLeu	missense_variant, disruptive_inframe_deletion		1	NM_033198.4	ENSP00000309430.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Glycosylphosphatidylinositol biosynthesis defect 18 Pathogenic:1

Pathogenic, no assertion criteria provided

literature only

OMIM

May 21, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1567614073; hg19: chr17-26881909;