17-3476178-GCTGAAGAACATATACAAAAGGTTGCTATCTTTGGAGGAACCCATGGGAATGAGCTAACCGGAGTATTTCTGGTTAAGCATTGGCTAGAGAATGGCGCTGAGATTCAGAGAACAGGGCTGGAGGTAAAACCATTTATTACTAACCCCAGAGCAGTGAAGAAGTGTACCAGATATATTGACTGTGACC-G
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate
The NM_000049.4(ASPA):c.20_205del(p.Ala7_Leu69delinsVal) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A7A) has been classified as Uncertain significance.
Frequency
Consequence
NM_000049.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- infertility disorderInheritance: AR Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Spongy degeneration of central nervous system Pathogenic:1
This variant, c.20_205del, is a complex sequence change that results in the deletion of 63 amino acid(s) in the ASPA protein (p.Ala7_Leu69delinsVal). This variant has not been reported in the literature in individuals affected with ASPA-related conditions. This variant disrupts a region of the ASPA protein in which other variant(s) (p.Ile16Thr) have been determined to be pathogenic (PMID: 8659549, 12638939). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at