17-35118534-GTCTTCAGTTCCTCGTAGAGA-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_002878.4(RAD51D):​c.210_229delTCTCTACGAGGAACTGAAGA​(p.Tyr72HisfsTer12) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

RAD51D
NM_002878.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.52
Variant links:
Genes affected
RAD51D (HGNC:9823): (RAD51 paralog D) The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, which are known to be involved in the homologous recombination and repair of DNA. This protein forms a complex with several other members of the RAD51 family, including RAD51L1, RAD51L2, and XRCC2. The protein complex formed with this protein has been shown to catalyze homologous pairing between single- and double-stranded DNA, and is thought to play a role in the early stage of recombinational repair of DNA. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream ring finger and FYVE-like domain containing 1 (RFFL) gene. [provided by RefSeq, Jan 2011]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-35118534-GTCTTCAGTTCCTCGTAGAGA-G is Pathogenic according to our data. Variant chr17-35118534-GTCTTCAGTTCCTCGTAGAGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 539848.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RAD51DNM_002878.4 linkc.210_229delTCTCTACGAGGAACTGAAGA p.Tyr72HisfsTer12 frameshift_variant Exon 3 of 10 ENST00000345365.11 NP_002869.3 O75771-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RAD51DENST00000345365.11 linkc.210_229delTCTCTACGAGGAACTGAAGA p.Tyr72HisfsTer12 frameshift_variant Exon 3 of 10 1 NM_002878.4 ENSP00000338790.6 O75771-1
ENSG00000267618ENST00000593039.5 linkc.3+2737_3+2756delTCTCTACGAGGAACTGAAGA intron_variant Intron 1 of 6 2 ENSP00000466834.1 K7EN88

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 4 Pathogenic:1
Jan 11, 2020
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Tyr72Hisfs*12) in the RAD51D gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with RAD51D-related conditions. ClinVar contains an entry for this variant (Variation ID: 539848). Loss-of-function variants in RAD51D are known to be pathogenic (PMID: 21822267). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555570266; hg19: chr17-33445553; API