NM_002878.4:c.210_229delTCTCTACGAGGAACTGAAGA
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_002878.4(RAD51D):c.210_229delTCTCTACGAGGAACTGAAGA(p.Tyr72HisfsTer12) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. D70D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002878.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- breast-ovarian cancer, familial, susceptibility to, 4Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary breast carcinomaInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002878.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RAD51D | NM_002878.4 | MANE Select | c.210_229delTCTCTACGAGGAACTGAAGA | p.Tyr72HisfsTer12 | frameshift | Exon 3 of 10 | NP_002869.3 | ||
| RAD51D | NM_001142571.2 | c.144+557_144+576delTCTCTACGAGGAACTGAAGA | intron | N/A | NP_001136043.1 | ||||
| RAD51D | NM_133629.3 | c.144+557_144+576delTCTCTACGAGGAACTGAAGA | intron | N/A | NP_598332.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RAD51D | ENST00000345365.11 | TSL:1 MANE Select | c.210_229delTCTCTACGAGGAACTGAAGA | p.Tyr72HisfsTer12 | frameshift | Exon 3 of 10 | ENSP00000338790.6 | ||
| RAD51D | ENST00000586186.3 | TSL:1 | c.210_229delTCTCTACGAGGAACTGAAGA | p.Tyr72HisfsTer12 | frameshift | Exon 3 of 9 | ENSP00000468273.3 | ||
| RAD51D | ENST00000585343.5 | TSL:1 | n.111_130delTCTCTACGAGGAACTGAAGA | non_coding_transcript_exon | Exon 2 of 6 | ENSP00000465007.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Breast-ovarian cancer, familial, susceptibility to, 4 Pathogenic:1
This sequence change creates a premature translational stop signal (p.Tyr72Hisfs*12) in the RAD51D gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with RAD51D-related conditions. ClinVar contains an entry for this variant (Variation ID: 539848). Loss-of-function variants in RAD51D are known to be pathogenic (PMID: 21822267). For these reasons, this variant has been classified as Pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at