rs1555570266

Variant names:

• chr17-35118534-GTCTTCAGTTCCTCGTAGAGA-G
• rs1555570266
• NM_002878.4:c.210_229delTCTCTACGAGGAACTGAAGA

Your query was ambiguous. Multiple possible variants found:

• chr17-35118534-GTCTTCAGTTCCTCGTAGAGA-G
• chr17-35118534-GTCTTCAGTTCCTCGTAGAGA-GTCTTCAGTTCCTCGTAGAGATCTTCAGTTCCTCGTAGAGA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_002878.4(RAD51D):​c.210_229delTCTCTACGAGGAACTGAAGA​(p.Tyr72HisfsTer12) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. D70D) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RAD51D NM_002878.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.52
• Publications: 0 publications found

Genes affected

RAD51D (HGNC:9823): (RAD51 paralog D) The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, which are known to be involved in the homologous recombination and repair of DNA. This protein forms a complex with several other members of the RAD51 family, including RAD51L1, RAD51L2, and XRCC2. The protein complex formed with this protein has been shown to catalyze homologous pairing between single- and double-stranded DNA, and is thought to play a role in the early stage of recombinational repair of DNA. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream ring finger and FYVE-like domain containing 1 (RFFL) gene. [provided by RefSeq, Jan 2011]

RAD51D Gene-Disease associations (from GenCC):

• RAD51D-related cancer predisposition

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• breast-ovarian cancer, familial, susceptibility to, 4

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000267618 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-35118534-GTCTTCAGTTCCTCGTAGAGA-G is Pathogenic according to our data. Variant chr17-35118534-GTCTTCAGTTCCTCGTAGAGA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 539848.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002878.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAD51D	NM_002878.4	MANE Select	c.210_229delTCTCTACGAGGAACTGAAGA	p.Tyr72HisfsTer12	frameshift	Exon 3 of 10	NP_002869.3
	RAD51D	NM_001142571.2		c.144+557_144+576delTCTCTACGAGGAACTGAAGA		intron	N/A	NP_001136043.1	O75771-8
	RAD51D	NM_133629.3		c.144+557_144+576delTCTCTACGAGGAACTGAAGA		intron	N/A	NP_598332.1	O75771-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RAD51D	ENST00000345365.11	TSL:1 MANE Select	c.210_229delTCTCTACGAGGAACTGAAGA	p.Tyr72HisfsTer12	frameshift	Exon 3 of 10	ENSP00000338790.6	O75771-1
	RAD51D	ENST00000586186.3	TSL:1	c.210_229delTCTCTACGAGGAACTGAAGA	p.Tyr72HisfsTer12	frameshift	Exon 3 of 9	ENSP00000468273.3	O75771-4
	ENSG00000267618	ENST00000593039.5	TSL:2	c.3+2737_3+2756delTCTCTACGAGGAACTGAAGA		intron	N/A	ENSP00000466834.1	K7EN88

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Breast-ovarian cancer, familial, susceptibility to, 4 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555570266; hg19: chr17-33445553;