17-35118534-GTCTTCAGTTCCTCGTAGAGA-GTCTTCAGTTCCTCGTAGAGATCTTCAGTTCCTCGTAGAGA

Variant names:

• chr17-35118534-G-GTCTTCAGTTCCTCGTAGAGA
• rs1555570266
• NM_002878.4:c.210_229dupTCTCTACGAGGAACTGAAGA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_002878.4(RAD51D):​c.210_229dupTCTCTACGAGGAACTGAAGA​(p.Thr77IlefsTer6) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T77T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RAD51D NM_002878.4 frameshift, stop_gained
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 4.75
• Publications: 0 publications found

Genes affected

RAD51D (HGNC:9823): (RAD51 paralog D) The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, which are known to be involved in the homologous recombination and repair of DNA. This protein forms a complex with several other members of the RAD51 family, including RAD51L1, RAD51L2, and XRCC2. The protein complex formed with this protein has been shown to catalyze homologous pairing between single- and double-stranded DNA, and is thought to play a role in the early stage of recombinational repair of DNA. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream ring finger and FYVE-like domain containing 1 (RFFL) gene. [provided by RefSeq, Jan 2011]

RAD51D Gene-Disease associations (from GenCC):

• breast-ovarian cancer, familial, susceptibility to, 4

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• hereditary breast ovarian cancer syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary breast carcinoma

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ENSG00000267618 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-35118534-G-GTCTTCAGTTCCTCGTAGAGA is Pathogenic according to our data. Variant chr17-35118534-G-GTCTTCAGTTCCTCGTAGAGA is described in ClinVar as Pathogenic. ClinVar VariationId is 480546.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RAD51D	NM_002878.4	c.210_229dupTCTCTACGAGGAACTGAAGA	p.Thr77IlefsTer6	frameshift_variant, stop_gained	Exon 3 of 10	ENST00000345365.11	NP_002869.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RAD51D	ENST00000345365.11	c.210_229dupTCTCTACGAGGAACTGAAGA	p.Thr77IlefsTer6	frameshift_variant, stop_gained	Exon 3 of 10	1	NM_002878.4	ENSP00000338790.6
ENSG00000267618	ENST00000593039.5	c.3+2737_3+2756dupTCTCTACGAGGAACTGAAGA		intron_variant	Intron 1 of 6	2		ENSP00000466834.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 4 Pathogenic:2

Jan 04, 2024

Myriad Genetics, Inc.

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Jan 21, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Thr77Ilefs*6) in the RAD51D gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RAD51D are known to be pathogenic (PMID: 21822267). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAD51D-related conditions. ClinVar contains an entry for this variant (Variation ID: 480546). For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Dec 04, 2023

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.210_229dup20 variant, located in coding exon 3 of the RAD51D gene, results from a duplication of TCTCTACGAGGAACTGAAGA at nucleotide position 210, causing a translational frameshift with a predicted alternate stop codon (p.T77Ifs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555570266; hg19: chr17-33445553;