chr17-35118534-G-GTCTTCAGTTCCTCGTAGAGA
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_002878.4(RAD51D):c.210_229dupTCTCTACGAGGAACTGAAGA(p.Thr77IlefsTer6) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. T77T) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002878.4 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- breast-ovarian cancer, familial, susceptibility to, 4Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hereditary breast carcinomaInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002878.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RAD51D | NM_002878.4 | MANE Select | c.210_229dupTCTCTACGAGGAACTGAAGA | p.Thr77IlefsTer6 | frameshift stop_gained | Exon 3 of 10 | NP_002869.3 | ||
| RAD51D | NM_001142571.2 | c.144+557_144+576dupTCTCTACGAGGAACTGAAGA | intron | N/A | NP_001136043.1 | ||||
| RAD51D | NM_133629.3 | c.144+557_144+576dupTCTCTACGAGGAACTGAAGA | intron | N/A | NP_598332.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RAD51D | ENST00000345365.11 | TSL:1 MANE Select | c.210_229dupTCTCTACGAGGAACTGAAGA | p.Thr77IlefsTer6 | frameshift stop_gained | Exon 3 of 10 | ENSP00000338790.6 | ||
| RAD51D | ENST00000586186.3 | TSL:1 | c.210_229dupTCTCTACGAGGAACTGAAGA | p.Thr77IlefsTer6 | frameshift stop_gained | Exon 3 of 9 | ENSP00000468273.3 | ||
| RAD51D | ENST00000585343.5 | TSL:1 | n.111_130dupTCTCTACGAGGAACTGAAGA | non_coding_transcript_exon | Exon 2 of 6 | ENSP00000465007.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Breast-ovarian cancer, familial, susceptibility to, 4 Pathogenic:2
This sequence change creates a premature translational stop signal (p.Thr77Ilefs*6) in the RAD51D gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RAD51D are known to be pathogenic (PMID: 21822267). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAD51D-related conditions. ClinVar contains an entry for this variant (Variation ID: 480546). For these reasons, this variant has been classified as Pathogenic.
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation.
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.210_229dup20 variant, located in coding exon 3 of the RAD51D gene, results from a duplication of TCTCTACGAGGAACTGAAGA at nucleotide position 210, causing a translational frameshift with a predicted alternate stop codon (p.T77Ifs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at