chr17-35118534-G-GTCTTCAGTTCCTCGTAGAGA
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_002878.4(RAD51D):c.210_229dupTCTCTACGAGGAACTGAAGA(p.Thr77IlefsTer6) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_002878.4 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 18 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RAD51D | ENST00000345365.11 | c.210_229dupTCTCTACGAGGAACTGAAGA | p.Thr77IlefsTer6 | frameshift_variant, stop_gained | Exon 3 of 10 | 1 | NM_002878.4 | ENSP00000338790.6 | ||
ENSG00000267618 | ENST00000593039.5 | c.3+2737_3+2756dupTCTCTACGAGGAACTGAAGA | intron_variant | Intron 1 of 6 | 2 | ENSP00000466834.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Breast-ovarian cancer, familial, susceptibility to, 4 Pathogenic:2
This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -
This sequence change creates a premature translational stop signal (p.Thr77Ilefs*6) in the RAD51D gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RAD51D are known to be pathogenic (PMID: 21822267). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAD51D-related conditions. ClinVar contains an entry for this variant (Variation ID: 480546). For these reasons, this variant has been classified as Pathogenic. -
Hereditary cancer-predisposing syndrome Pathogenic:1
The c.210_229dup20 variant, located in coding exon 3 of the RAD51D gene, results from a duplication of TCTCTACGAGGAACTGAAGA at nucleotide position 210, causing a translational frameshift with a predicted alternate stop codon (p.T77Ifs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at