chr17-35118534-G-GTCTTCAGTTCCTCGTAGAGA

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_002878.4(RAD51D):​c.210_229dupTCTCTACGAGGAACTGAAGA​(p.Thr77IlefsTer6) variant causes a frameshift, stop gained change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

RAD51D
NM_002878.4 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:3

Conservation

PhyloP100: 4.75
Variant links:
Genes affected
RAD51D (HGNC:9823): (RAD51 paralog D) The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, which are known to be involved in the homologous recombination and repair of DNA. This protein forms a complex with several other members of the RAD51 family, including RAD51L1, RAD51L2, and XRCC2. The protein complex formed with this protein has been shown to catalyze homologous pairing between single- and double-stranded DNA, and is thought to play a role in the early stage of recombinational repair of DNA. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream ring finger and FYVE-like domain containing 1 (RFFL) gene. [provided by RefSeq, Jan 2011]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-35118534-G-GTCTTCAGTTCCTCGTAGAGA is Pathogenic according to our data. Variant chr17-35118534-G-GTCTTCAGTTCCTCGTAGAGA is described in ClinVar as [Pathogenic]. Clinvar id is 480546.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
RAD51DNM_002878.4 linkc.210_229dupTCTCTACGAGGAACTGAAGA p.Thr77IlefsTer6 frameshift_variant, stop_gained Exon 3 of 10 ENST00000345365.11 NP_002869.3 O75771-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
RAD51DENST00000345365.11 linkc.210_229dupTCTCTACGAGGAACTGAAGA p.Thr77IlefsTer6 frameshift_variant, stop_gained Exon 3 of 10 1 NM_002878.4 ENSP00000338790.6 O75771-1
ENSG00000267618ENST00000593039.5 linkc.3+2737_3+2756dupTCTCTACGAGGAACTGAAGA intron_variant Intron 1 of 6 2 ENSP00000466834.1 K7EN88

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 4 Pathogenic:2
Jan 04, 2024
Myriad Genetics, Inc.
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is considered pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Jan 21, 2025
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Thr77Ilefs*6) in the RAD51D gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in RAD51D are known to be pathogenic (PMID: 21822267). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAD51D-related conditions. ClinVar contains an entry for this variant (Variation ID: 480546). For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1
Dec 04, 2023
Ambry Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.210_229dup20 variant, located in coding exon 3 of the RAD51D gene, results from a duplication of TCTCTACGAGGAACTGAAGA at nucleotide position 210, causing a translational frameshift with a predicted alternate stop codon (p.T77Ifs*6). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555570266; hg19: chr17-33445553; API