17-40818851-A-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT

Variant names:

• chr17-40818851-A-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT
• rs776920005
• NM_000421.5:c.1654_1683dupAGCTCCGGCGGCGGATACGGCGGCGGCAGC

Variant summary

Our verdict is Benign. Variant got -14 ACMG points: 2P and 16B. PM4 BP6_Very_Strong BA1

The NM_000421.5(KRT10):​c.1654_1683dupAGCTCCGGCGGCGGATACGGCGGCGGCAGC​(p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySer) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0897 in 1,344,600 control chromosomes in the GnomAD database, including 10,425 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.16 (2321 hom., cov: 33)
  • Exomes 𝑓: 0.083 (8104 hom.)
• Consequence: KRT10 NM_000421.5 conservative_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: -0.0440

Genes affected

KRT10 (HGNC:6413): (keratin 10) This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]

KRT10-AS1 (HGNC:28305): (KRT10 antisense RNA 1) Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Benign. Variant got -14 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000421.5.
• BP6: Variant 17-40818851-A-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT is Benign according to our data. Variant chr17-40818851-A-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT is described in ClinVar as [Likely_benign]. Clinvar id is 516735.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.293 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KRT10	NM_000421.5	c.1654_1683dupAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8	ENST00000269576.6	NP_000412.4
KRT10	NM_001379366.1	c.1654_1683dupAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8		NP_001366295.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KRT10	ENST00000269576.6	c.1654_1683dupAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8	1	NM_000421.5	ENSP00000269576.5
KRT10	ENST00000635956.2	c.1654_1683dupAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8	2		ENSP00000490524.2
KRT10-AS1	ENST00000301665.9	n.-250_-249insGCTGCCGCCGCCGTATCCGCCGCCGGAGCT		upstream_gene_variant		2
KRT10-AS1	ENST00000436612.6	n.-251_-250insGCTGCCGCCGCCGTATCCGCCGCCGGAGCT		upstream_gene_variant		2

Frequencies

GnomAD3 genomes AF: 0.157 AC: 20235 AN: 129164 Hom.: 2319 Cov.: 33

Gnomad AFR AF: 0.298

Gnomad AMI AF: 0.0542

Gnomad AMR AF: 0.106

Gnomad ASJ AF: 0.113

Gnomad EAS AF: 0.188

Gnomad SAS AF: 0.192

Gnomad FIN AF: 0.0837

Gnomad MID AF: 0.146

Gnomad NFE AF: 0.104

Gnomad OTH AF: 0.150

GnomAD4 exome AF: 0.0826 AC: 100365 AN: 1215346 Hom.: 8104 Cov.: 31 AF XY: 0.0829 AC XY: 50199 AN XY: 605680

Gnomad4 AFR exome AF: 0.250

Gnomad4 AMR exome AF: 0.0428

Gnomad4 ASJ exome AF: 0.0724

Gnomad4 EAS exome AF: 0.173

Gnomad4 SAS exome AF: 0.110

Gnomad4 FIN exome AF: 0.0817

Gnomad4 NFE exome AF: 0.0744

Gnomad4 OTH exome AF: 0.0998

GnomAD4 genome AF: 0.157 AC: 20246 AN: 129254 Hom.: 2321 Cov.: 33 AF XY: 0.156 AC XY: 9817 AN XY: 62940

Gnomad4 AFR AF: 0.298

Gnomad4 AMR AF: 0.106

Gnomad4 ASJ AF: 0.113

Gnomad4 EAS AF: 0.188

Gnomad4 SAS AF: 0.192

Gnomad4 FIN AF: 0.0837

Gnomad4 NFE AF: 0.104

Gnomad4 OTH AF: 0.148

Alfa AF: 0.0296 Hom.: 65

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Jan 14, 2018

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

KRT10-related disorder Benign:1

May 05, 2020

PreventionGenetics, part of Exact Sciences

Significance: Benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

not provided Benign:1

Jan 30, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Epidermolytic ichthyosis;C1843463:Annular epidermolytic ichthyosis;C3665704:Congenital reticular ichthyosiform erythroderma Benign:1

Aug 11, 2021

Fulgent Genetics, Fulgent Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs776920005; hg19: chr17-38975103;