17-40818851-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT-A

Variant names:

• chr17-40818851-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT-A
• rs776920005
• NM_000421.5:c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000421.5(KRT10):​c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC​(p.Ser552_Ser561del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.0000259 in 1,275,478 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.000026 (0 hom.)
• Consequence: KRT10 NM_000421.5 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 6.15
• Publications: 0 publications found

Genes affected

KRT10 (HGNC:6413): (keratin 10) This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]

KRT10-AS1 (HGNC:28305): (KRT10 antisense RNA 1) Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000421.5.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000421.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KRT10	NM_000421.5	MANE Select	c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser552_Ser561del	conservative_inframe_deletion	Exon 7 of 8	NP_000412.4
	KRT10	NM_001379366.1		c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser552_Ser561del	conservative_inframe_deletion	Exon 7 of 8	NP_001366295.1	A0A1B0GVI3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KRT10	ENST00000269576.6	TSL:1 MANE Select	c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser552_Ser561del	conservative_inframe_deletion	Exon 7 of 8	ENSP00000269576.5	P13645
	KRT10	ENST00000635956.2	TSL:2	c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser552_Ser561del	conservative_inframe_deletion	Exon 7 of 8	ENSP00000490524.2	A0A1B0GVI3
	KRT10-AS1	ENST00000301665.10	TSL:2	n.-246_-217delGCTGCCGCCGCCGTATCCGCCGCCGGAGCT		upstream_gene	N/A

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.0000259 AC: 33 AN: 1275478 Hom.: 0 AF XY: 0.0000221 AC XY: 14 AN XY: 634488

African (AFR) AF: 0.00 AC: 0 AN: 25136

American (AMR) AF: 0.00 AC: 0 AN: 38834

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23194

East Asian (EAS) AF: 0.00 AC: 0 AN: 33122

South Asian (SAS) AF: 0.00 AC: 0 AN: 70898

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 33374

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4914

European-Non Finnish (NFE) AF: 0.0000322 AC: 32 AN: 993750

Other (OTH) AF: 0.0000191 AC: 1 AN: 52256

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs776920005; hg19: chr17-38975103;