NM_000421.5:c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC

Variant names:

• chr17-40818851-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT-A
• NM_000421.5:c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_000421.5(KRT10):​c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC​(p.Ser552_Ser561del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.0000259 in 1,275,478 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.000026 (0 hom.)
• Consequence: KRT10 NM_000421.5 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 6.15

Genes affected

KRT10 (HGNC:6413): (keratin 10) This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]

KRT10-AS1 (HGNC:28305): (KRT10 antisense RNA 1) Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000421.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KRT10	NM_000421.5	c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser552_Ser561del	conservative_inframe_deletion	Exon 7 of 8	ENST00000269576.6	NP_000412.4
KRT10	NM_001379366.1	c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser552_Ser561del	conservative_inframe_deletion	Exon 7 of 8		NP_001366295.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KRT10	ENST00000269576.6	c.1654_1683delAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser552_Ser561del	conservative_inframe_deletion	Exon 7 of 8	1	NM_000421.5	ENSP00000269576.5

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.0000259 AC: 33 AN: 1275478 Hom.: 0 AF XY: 0.0000221 AC XY: 14 AN XY: 634488

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000322

Gnomad4 OTH exome AF: 0.0000191

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-38975103;