17-40818851-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCT-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCTGCTGCCGCCGCCGTATCCGCCGCCGGAGCTGCTGCCGCCGCCGTATCCGCCGCCGGAGCT

Variant names:

• chr17-40818851-A-AGCTGCCGCCGCCGTATCCGCCGCCGGAGCTGCTGCCGCCGCCGTATCCGCCGCCGGAGCT
• rs776920005
• NM_000421.5:c.1683_1684insAGCTCCGGCGGCGGATACGGCGGCGGCAGCAGCTCCGGCGGCGGATACGGCGGCGGCAGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4

The NM_000421.5(KRT10):​c.1683_1684insAGCTCCGGCGGCGGATACGGCGGCGGCAGCAGCTCCGGCGGCGGATACGGCGGCGGCAGC​(p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySerSerSerGlyGlyGlyTyrGlyGlyGlySer) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: 𝑓 0.020 (209 hom., cov: 33)
  • Exomes 𝑓: 0.0079 (460 hom.)
  • Failed GnomAD Quality Control
• Consequence: KRT10 NM_000421.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: -0.0440

Genes affected

KRT10 (HGNC:6413): (keratin 10) This gene encodes a member of the type I (acidic) cytokeratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. Mutations in this gene are associated with epidermolytic hyperkeratosis. This gene is located within a cluster of keratin family members on chromosome 17q21. [provided by RefSeq, Jul 2008]

KRT10-AS1 (HGNC:28305): (KRT10 antisense RNA 1) Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000421.5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KRT10	NM_000421.5	c.1683_1684insAGCTCCGGCGGCGGATACGGCGGCGGCAGCAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySerSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8	ENST00000269576.6	NP_000412.4
KRT10	NM_001379366.1	c.1683_1684insAGCTCCGGCGGCGGATACGGCGGCGGCAGCAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySerSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8		NP_001366295.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KRT10	ENST00000269576.6	c.1683_1684insAGCTCCGGCGGCGGATACGGCGGCGGCAGCAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySerSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8	1	NM_000421.5	ENSP00000269576.5
KRT10	ENST00000635956.2	c.1683_1684insAGCTCCGGCGGCGGATACGGCGGCGGCAGCAGCTCCGGCGGCGGATACGGCGGCGGCAGC	p.Ser561_Ser562insSerSerGlyGlyGlyTyrGlyGlyGlySerSerSerGlyGlyGlyTyrGlyGlyGlySer	conservative_inframe_insertion	Exon 7 of 8	2		ENSP00000490524.2
KRT10-AS1	ENST00000301665.9	n.-250_-249insGCTGCCGCCGCCGTATCCGCCGCCGGAGCTGCTGCCGCCGCCGTATCCGCCGCCGGAGCT		upstream_gene_variant		2
KRT10-AS1	ENST00000436612.6	n.-251_-250insGCTGCCGCCGCCGTATCCGCCGCCGGAGCTGCTGCCGCCGCCGTATCCGCCGCCGGAGCT		upstream_gene_variant		2

Frequencies

GnomAD3 genomes AF: 0.00 AC: 2640 AN: 130536 Hom.: 210 Cov.: 33 FAILED QC

Gnomad AFR AF: 0.0172

Gnomad AMI AF: 0.0223

Gnomad AMR AF: 0.0172

Gnomad ASJ AF: 0.0316

Gnomad EAS AF: 0.0856

Gnomad SAS AF: 0.0230

Gnomad FIN AF: 0.0179

Gnomad MID AF: 0.0257

Gnomad NFE AF: 0.0175

Gnomad OTH AF: 0.0278

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00791 AC: 10080 AN: 1273676 Hom.: 460 Cov.: 31 AF XY: 0.00818 AC XY: 5184 AN XY: 633478

Gnomad4 AFR exome AF: 0.00864

Gnomad4 AMR exome AF: 0.00495

Gnomad4 ASJ exome AF: 0.0219

Gnomad4 EAS exome AF: 0.0568

Gnomad4 SAS exome AF: 0.00605

Gnomad4 FIN exome AF: 0.0234

Gnomad4 NFE exome AF: 0.00535

Gnomad4 OTH exome AF: 0.0136

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0202 AC: 2639 AN: 130638 Hom.: 209 Cov.: 33 AF XY: 0.0198 AC XY: 1260 AN XY: 63564

Gnomad4 AFR AF: 0.0172

Gnomad4 AMR AF: 0.0172

Gnomad4 ASJ AF: 0.0316

Gnomad4 EAS AF: 0.0859

Gnomad4 SAS AF: 0.0228

Gnomad4 FIN AF: 0.0179

Gnomad4 NFE AF: 0.0175

Gnomad4 OTH AF: 0.0269

Alfa AF: 0.000791 Hom.: 65

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:2

-

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

The KRT10 p.Gly565_His566ins20 variant was not identified in the literature nor was it identified in dbSNP, ClinVar, LOVD 3.0 or the following control databases: the 1000 Genomes Project, the NHLBI GO Exome Sequencing Project, the Exome Aggregation Consortium (August 8th 2016), or the Genome Aggregation Database (Feb 27, 2017). This variant is an in-frame insertion resulting in the insertion of 20 amino acids beginning at codon 565; the impact of this alteration on KRT10 protein function is not known. In summary, based on the above information the clinical significance of this variant cannot be determined with certainty at this time. This variant is classified as a variant of uncertain significance. -

Nov 11, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.1683_1684ins60, results in the insertion of 20 amino acid(s) of the KRT10 protein (p.Gly565_His566ins20), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with KRT10-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Epidermolytic ichthyosis;C1843463:Annular epidermolytic ichthyosis;C3665704:Congenital reticular ichthyosiform erythroderma Uncertain:1

Jan 28, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs776920005; hg19: chr17-38975103;