17-4899318-AGGCGGCCCGGGGGGCCTCGGGC-AGGCGGCCCGGGGGGCCTCGGGCGGCGGCCCGGGGGGCCTCGGGC

Variant names:

• chr17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC
• rs1555546315
• NM_000080.4:c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000080.4(CHRNE):​c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC​(p.Ser367AlafsTer37) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000705 in 1,418,710 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A366A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
• Consequence: CHRNE NM_000080.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.183

Genes affected

CHRNE (HGNC:1966): (cholinergic receptor nicotinic epsilon subunit) Acetylcholine receptors at mature mammalian neuromuscular junctions are pentameric protein complexes composed of four subunits in the ratio of two alpha subunits to one beta, one epsilon, and one delta subunit. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. Mutations in the epsilon subunit are associated with congenital myasthenic syndrome. [provided by RefSeq, Sep 2009]

C17orf107 (HGNC:37238): (chromosome 17 open reading frame 107)

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC is Pathogenic according to our data. Variant chr17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC is described in ClinVar as [Pathogenic]. Clinvar id is 465853.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CHRNE	NM_000080.4	c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC	p.Ser367AlafsTer37	frameshift_variant	Exon 10 of 12	ENST00000649488.2	NP_000071.1
C17orf107	NM_001145536.2	c.-445_-444insGGCGGCCCGGGGGGCCTCGGGC		upstream_gene_variant		ENST00000381365.4	NP_001139008.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CHRNE	ENST00000649488.2	c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC	p.Ser367AlafsTer37	frameshift_variant	Exon 10 of 12		NM_000080.4	ENSP00000497829.1
C17orf107	ENST00000381365.4	c.-445_-444insGGCGGCCCGGGGGGCCTCGGGC		upstream_gene_variant		2	NM_001145536.2	ENSP00000370770.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 7.05e-7 AC: 1 AN: 1418710 Hom.: 0 Cov.: 35 AF XY: 0.00 AC XY: 0 AN XY: 703676

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000251

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Congenital myasthenic syndrome 4A Pathogenic:1

Mar 22, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. This sequence change creates a premature translational stop signal (p.Ser367Alafs*37) in the CHRNE gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CHRNE are known to be pathogenic (PMID: 22678886). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CHRNE-related conditions. ClinVar contains an entry for this variant (Variation ID: 465853). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555546315; hg19: chr17-4802613;