chr17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC

Position:

• chr17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000080.4(CHRNE):​c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC​(p.Ser367fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000705 in 1,418,710 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
• Consequence: CHRNE NM_000080.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 0.183

Genes affected

CHRNE (HGNC:1966): (cholinergic receptor nicotinic epsilon subunit) Acetylcholine receptors at mature mammalian neuromuscular junctions are pentameric protein complexes composed of four subunits in the ratio of two alpha subunits to one beta, one epsilon, and one delta subunit. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. Mutations in the epsilon subunit are associated with congenital myasthenic syndrome. [provided by RefSeq, Sep 2009]

CHRNE (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC is Pathogenic according to our data. Variant chr17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC is described in ClinVar as [Pathogenic]. Clinvar id is 465853.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CHRNE	NM_000080.4	c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC	p.Ser367fs	frameshift_variant	10/12	ENST00000649488.2	NP_000071.1
CHRNE	XM_017024115.2	c.1041_1062dupGCCCGAGGCCCCCCGGGCCGCC	p.Ser355fs	frameshift_variant	11/13		XP_016879604.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CHRNE	ENST00000649488.2	c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC	p.Ser367fs	frameshift_variant	10/12		NM_000080.4	ENSP00000497829.1
CHRNE	ENST00000649830.1	c.144_165dupGCCCGAGGCCCCCCGGGCCGCC	p.Ser56fs	frameshift_variant	10/11			ENSP00000496907.1
CHRNE	ENST00000572438.1	n.763_784dupGCCCGAGGCCCCCCGGGCCGCC		non_coding_transcript_exon_variant	5/7	5
CHRNE	ENST00000652550.1	n.807_828dupGCCCGAGGCCCCCCGGGCCGCC		non_coding_transcript_exon_variant	2/4

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 7.05e-7 AC: 1 AN: 1418710 Hom.: 0 Cov.: 35 AF XY: 0.00 AC XY: 0 AN XY: 703676

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000251

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Congenital myasthenic syndrome 4A Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Mar 22, 2022

This variant has not been reported in the literature in individuals affected with CHRNE-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Ser367Alafs*37) in the CHRNE gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CHRNE are known to be pathogenic (PMID: 22678886). ClinVar contains an entry for this variant (Variation ID: 465853). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555546315; hg19: chr17-4802613;