chr17-4899318-A-AGGCGGCCCGGGGGGCCTCGGGC
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000080.4(CHRNE):c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC(p.Ser367AlafsTer37) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000000705 in 1,418,710 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A366A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000080.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 12 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CHRNE | NM_000080.4 | c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC | p.Ser367AlafsTer37 | frameshift_variant | Exon 10 of 12 | ENST00000649488.2 | NP_000071.1 | |
C17orf107 | NM_001145536.2 | c.-445_-444insGGCGGCCCGGGGGGCCTCGGGC | upstream_gene_variant | ENST00000381365.4 | NP_001139008.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CHRNE | ENST00000649488.2 | c.1077_1098dupGCCCGAGGCCCCCCGGGCCGCC | p.Ser367AlafsTer37 | frameshift_variant | Exon 10 of 12 | NM_000080.4 | ENSP00000497829.1 | |||
C17orf107 | ENST00000381365.4 | c.-445_-444insGGCGGCCCGGGGGGCCTCGGGC | upstream_gene_variant | 2 | NM_001145536.2 | ENSP00000370770.3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 7.05e-7 AC: 1AN: 1418710Hom.: 0 Cov.: 35 AF XY: 0.00 AC XY: 0AN XY: 703676
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Congenital myasthenic syndrome 4A Pathogenic:1
For these reasons, this variant has been classified as Pathogenic. This sequence change creates a premature translational stop signal (p.Ser367Alafs*37) in the CHRNE gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in CHRNE are known to be pathogenic (PMID: 22678886). This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CHRNE-related conditions. ClinVar contains an entry for this variant (Variation ID: 465853). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at