rs1555546315

Variant names:

• chr17-4899318-AGGCGGCCCGGGGGGCCTCGGGC-A
• rs1555546315
• NM_000080.4:c.1077_1098delGCCCGAGGCCCCCCGGGCCGCC

Your query was ambiguous. Multiple possible variants found:

• chr17-4899318-AGGCGGCCCGGGGGGCCTCGGGC-A
• chr17-4899318-AGGCGGCCCGGGGGGCCTCGGGC-AGGCGGCCCGGGGGGCCTCGGGCGGCGGCCCGGGGGGCCTCGGGC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000080.4(CHRNE):​c.1077_1098delGCCCGAGGCCCCCCGGGCCGCC​(p.Pro360ArgfsTer18) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. P359P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CHRNE NM_000080.4 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.93
• Publications: 0 publications found

Genes affected

CHRNE (HGNC:1966): (cholinergic receptor nicotinic epsilon subunit) Acetylcholine receptors at mature mammalian neuromuscular junctions are pentameric protein complexes composed of four subunits in the ratio of two alpha subunits to one beta, one epsilon, and one delta subunit. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. Mutations in the epsilon subunit are associated with congenital myasthenic syndrome. [provided by RefSeq, Sep 2009]

C17orf107 (HGNC:37238): (chromosome 17 open reading frame 107)

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000080.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHRNE	NM_000080.4	MANE Select	c.1077_1098delGCCCGAGGCCCCCCGGGCCGCC	p.Pro360ArgfsTer18	frameshift	Exon 10 of 12	NP_000071.1
	C17orf107	NM_001145536.2	MANE Select	c.-444_-423delGGCGGCCCGGGGGGCCTCGGGC		upstream_gene	N/A	NP_001139008.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CHRNE	ENST00000649488.2	MANE Select	c.1077_1098delGCCCGAGGCCCCCCGGGCCGCC	p.Pro360ArgfsTer18	frameshift	Exon 10 of 12	ENSP00000497829.1
	CHRNE	ENST00000649830.1		c.144_165delGCCCGAGGCCCCCCGGGCCGCC	p.Pro49ArgfsTer18	frameshift	Exon 10 of 11	ENSP00000496907.1
	CHRNE	ENST00000572438.1	TSL:5	n.763_784delGCCCGAGGCCCCCCGGGCCGCC		non_coding_transcript_exon	Exon 5 of 7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555546315; hg19: chr17-4802613;