17-58692597-AGGGCGTGCGGAGTTTGGCTGCTCCGGGGTTAGCAGGTGAGCCTGCGATGCGCGGGAAGACGTTCCGCTTTGAAATGCAGCGGGATTTGGTGAGTTTCCCGCTGTCTCCAGCG-A

Position:

• chr17-58692597-AGGGCGTGCGGAGTTTGGCTGCTCCGGGGTTAGCAGGTGAGCCTGCGATGCGCGGGAAGACGTTCCGCTTTGAAATGCAGCGGGATTTGGTGAGTTTCCCGCTGTCTCCAGCG-A

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_058216.3(RAD51C):​c.-45_67del variant causes a 5 prime UTR truncation, exon loss change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: RAD51C NM_058216.3 5_prime_UTR_truncation, exon_loss
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.648

Genes affected

RAD51C (HGNC:9820): (RAD51 paralog C) This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RAD51C	NM_058216.3	c.-45_67del	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 9	ENST00000337432.9	NP_478123.1
RAD51C	NM_058216.3	c.-45_67del		5_prime_UTR_truncation, exon_loss_variant	Exon 1 of 9	ENST00000337432.9	NP_478123.1
RAD51C	NM_058216.3	c.-46_66del		upstream_gene_variant		ENST00000337432.9	NP_478123.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RAD51C	ENST00000337432.9	c.-45_67del	p.Met1fs	frameshift_variant, start_lost	Exon 1 of 9	1	NM_058216.3	ENSP00000336701.4
RAD51C	ENST00000337432	c.-45_67del		5_prime_UTR_truncation, exon_loss_variant	Exon 1 of 9	1	NM_058216.3	ENSP00000336701.4
RAD51C	ENST00000337432.9	c.-46_66del		upstream_gene_variant		1	NM_058216.3	ENSP00000336701.4

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Fanconi anemia complementation group O Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Sep 10, 2024

This variant results in the deletion of part of exon 1 (c.-45_67del) of the RAD51C gene. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RAD51C-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr17-56769958;