17-65536452-GGGTGCCCGCTGTTGCCCCCCCACAGAT-G
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_004655.4(AXIN2):c.1982_2008del(p.His661_His669del) variant causes a inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Genomes: not found (cov: 33)
Consequence
AXIN2
NM_004655.4 inframe_deletion
NM_004655.4 inframe_deletion
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 7.44
Genes affected
AXIN2 (HGNC:904): (axin 2) The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 4 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_004655.4.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
AXIN2 | NM_004655.4 | c.1982_2008del | p.His661_His669del | inframe_deletion | 8/11 | ENST00000307078.10 | NP_004646.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
AXIN2 | ENST00000307078.10 | c.1982_2008del | p.His661_His669del | inframe_deletion | 8/11 | 1 | NM_004655.4 | ENSP00000302625 | P1 | |
AXIN2 | ENST00000375702.5 | c.1787_1813del | p.His596_His604del | inframe_deletion | 6/9 | 1 | ENSP00000364854 | |||
AXIN2 | ENST00000618960.4 | c.1787_1813del | p.His596_His604del | inframe_deletion | 7/10 | 5 | ENSP00000478916 | |||
AXIN2 | ENST00000578251.1 | n.204_230del | non_coding_transcript_exon_variant | 1/3 | 3 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Oligodontia-cancer predisposition syndrome Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Dec 19, 2023 | This variant, c.1982_2008del, results in the deletion of 9 amino acid(s) of the AXIN2 protein (p.His661_His669del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with AXIN2-related conditions. ClinVar contains an entry for this variant (Variation ID: 533222). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. - |
Colorectal cancer Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Baylor Genetics | Mar 30, 2024 | - - |
Hereditary cancer-predisposing syndrome Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Ambry Genetics | Apr 06, 2022 | The c.1982_2008del27 variant (also known as p.H661_H669del) is located in coding exon 7 of the AXIN2 gene. This variant results from an in-frame ATCTGTGGGGGGGCAACAGCGGGCACC deletion at nucleotide positions 1982 to 2008. This results in the in-frame deletion of HLWGGNSGH at codons 661 through 669. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at