rs1555577132

Positions:

• chr17-65536452-GGGTGCCCGCTGTTGCCCCCCCACAGAT-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_004655.4(AXIN2):​c.1982_2008del​(p.His661_His669del) variant causes a inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: AXIN2 NM_004655.4 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 7.44

Genes affected

AXIN2 (HGNC:904): (axin 2) The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_004655.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AXIN2	NM_004655.4	c.1982_2008del	p.His661_His669del	inframe_deletion	8/11	ENST00000307078.10	NP_004646.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AXIN2	ENST00000307078.10	c.1982_2008del	p.His661_His669del	inframe_deletion	8/11	1	NM_004655.4	ENSP00000302625	P1
AXIN2	ENST00000375702.5	c.1787_1813del	p.His596_His604del	inframe_deletion	6/9	1		ENSP00000364854
AXIN2	ENST00000618960.4	c.1787_1813del	p.His596_His604del	inframe_deletion	7/10	5		ENSP00000478916
AXIN2	ENST00000578251.1	n.204_230del		non_coding_transcript_exon_variant	1/3	3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Oligodontia-cancer predisposition syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 19, 2023

This variant, c.1982_2008del, results in the deletion of 9 amino acid(s) of the AXIN2 protein (p.His661_His669del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with AXIN2-related conditions. ClinVar contains an entry for this variant (Variation ID: 533222). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Colorectal cancer Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Baylor Genetics

Mar 30, 2024

- -

Hereditary cancer-predisposing syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Ambry Genetics

Apr 06, 2022

The c.1982_2008del27 variant (also known as p.H661_H669del) is located in coding exon 7 of the AXIN2 gene. This variant results from an in-frame ATCTGTGGGGGGGCAACAGCGGGCACC deletion at nucleotide positions 1982 to 2008. This results in the in-frame deletion of HLWGGNSGH at codons 661 through 669. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555577132; hg19: chr17-63532570;