rs1555577132

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_004655.4(AXIN2):​c.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC​(p.His661_His669del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. H661H) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 33)

Consequence

AXIN2
NM_004655.4 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:3

Conservation

PhyloP100: 7.44

Publications

0 publications found
Variant links:
Genes affected
AXIN2 (HGNC:904): (axin 2) The Axin-related protein, Axin2, presumably plays an important role in the regulation of the stability of beta-catenin in the Wnt signaling pathway, like its rodent homologs, mouse conductin/rat axil. In mouse, conductin organizes a multiprotein complex of APC (adenomatous polyposis of the colon), beta-catenin, glycogen synthase kinase 3-beta, and conductin, which leads to the degradation of beta-catenin. Apparently, the deregulation of beta-catenin is an important event in the genesis of a number of malignancies. The AXIN2 gene has been mapped to 17q23-q24, a region that shows frequent loss of heterozygosity in breast cancer, neuroblastoma, and other tumors. Mutations in this gene have been associated with colorectal cancer with defective mismatch repair. [provided by RefSeq, Jul 2008]
AXIN2 Gene-Disease associations (from GenCC):
  • oligodontia-cancer predisposition syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)
  • tooth agenesis
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • craniosynostosis
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_004655.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
AXIN2NM_004655.4 linkc.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC p.His661_His669del disruptive_inframe_deletion Exon 8 of 11 ENST00000307078.10 NP_004646.3 Q9Y2T1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
AXIN2ENST00000307078.10 linkc.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC p.His661_His669del disruptive_inframe_deletion Exon 8 of 11 1 NM_004655.4 ENSP00000302625.5 Q9Y2T1
AXIN2ENST00000375702.5 linkc.1787_1813delATCTGTGGGGGGGCAACAGCGGGCACC p.His596_His604del disruptive_inframe_deletion Exon 6 of 9 1 ENSP00000364854.5 E7ES00
AXIN2ENST00000618960.4 linkc.1787_1813delATCTGTGGGGGGGCAACAGCGGGCACC p.His596_His604del disruptive_inframe_deletion Exon 7 of 10 5 ENSP00000478916.1 E7ES00
AXIN2ENST00000578251.1 linkn.204_230delATCTGTGGGGGGGCAACAGCGGGCACC non_coding_transcript_exon_variant Exon 1 of 3 3

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:3
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Oligodontia-cancer predisposition syndrome Uncertain:1
May 14, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.1982_2008del, results in the deletion of 9 amino acid(s) of the AXIN2 protein (p.His661_His669del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with AXIN2-related conditions. ClinVar contains an entry for this variant (Variation ID: 533222). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Colorectal cancer Uncertain:1
Mar 30, 2024
Baylor Genetics
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Hereditary cancer-predisposing syndrome Uncertain:1
May 04, 2025
Ambry Genetics
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.1982_2008del27 variant (also known as p.H661_H669del) is located in coding exon 7 of the AXIN2 gene. This variant results from an in-frame ATCTGTGGGGGGGCAACAGCGGGCACC deletion at nucleotide positions 1982 to 2008. This results in the in-frame deletion of HLWGGNSGH at codons 661 through 669. This amino acid region is not well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555577132; hg19: chr17-63532570; API