17-74919984-GGAGACGCTGTCCTCGTCCGA-G

Position:

• chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_173477.5(USH1G):​c.832_851delTCGGACGAGGACAGCGTCTC​(p.Ser278fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: USH1G NM_173477.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:4 O:1
• Conservation: PhyloP100: 9.32

Genes affected

USH1G (HGNC:16356): (USH1 protein network component sans) This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.4 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 17-74919984-GGAGACGCTGTCCTCGTCCGA-G is Pathogenic according to our data. Variant chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 2916.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
USH1G	NM_173477.5	c.832_851delTCGGACGAGGACAGCGTCTC	p.Ser278fs	frameshift_variant	2/3	ENST00000614341.5	NP_775748.2
USH1G	NM_001282489.3	c.523_542delTCGGACGAGGACAGCGTCTC	p.Ser175fs	frameshift_variant	2/3		NP_001269418.1
USH1G	XM_011524296.2	c.523_542delTCGGACGAGGACAGCGTCTC	p.Ser175fs	frameshift_variant	2/3		XP_011522598.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
USH1G	ENST00000614341.5	c.832_851delTCGGACGAGGACAGCGTCTC	p.Ser278fs	frameshift_variant	2/3	1	NM_173477.5	ENSP00000480279.1
USH1G	ENST00000579243.1	n.*431_*450delTCGGACGAGGACAGCGTCTC		non_coding_transcript_exon_variant	2/3	2		ENSP00000462568.1
USH1G	ENST00000579243.1	n.*431_*450delTCGGACGAGGACAGCGTCTC		3_prime_UTR_variant	2/3	2		ENSP00000462568.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:4 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Usher syndrome type 1G Pathogenic:4

Pathogenic, criteria provided, single submitter	clinical testing	Mayo Clinic Laboratories, Mayo Clinic	Nov 28, 2016	- -
Pathogenic, no assertion criteria provided	literature only	OMIM	Mar 01, 2003	- -
Pathogenic, no assertion criteria provided	curation	GeneReviews	Jun 20, 2013	- -
Pathogenic, no assertion criteria provided	research	Hereditary Research Laboratory, Bethlehem University	Jun 04, 2016	profound w/retinitis pigmentosum -

Usher syndrome type 1 Other:1

not provided, no classification provided

literature only

GeneReviews

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397515345; hg19: chr17-72916079;