17-74919984-GGAGACGCTGTCCTCGTCCGA-G
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_173477.5(USH1G):c.832_851delTCGGACGAGGACAGCGTCTC(p.Ser278ProfsTer71) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_173477.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- Usher syndrome type 1Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- Usher syndrome type 1GInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, PanelApp Australia, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- nonsyndromic genetic hearing lossInheritance: AR Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| USH1G | NM_173477.5 | c.832_851delTCGGACGAGGACAGCGTCTC | p.Ser278ProfsTer71 | frameshift_variant | Exon 2 of 3 | ENST00000614341.5 | NP_775748.2 | |
| USH1G | NM_001282489.3 | c.523_542delTCGGACGAGGACAGCGTCTC | p.Ser175ProfsTer71 | frameshift_variant | Exon 2 of 3 | NP_001269418.1 | ||
| USH1G | XM_011524296.2 | c.523_542delTCGGACGAGGACAGCGTCTC | p.Ser175ProfsTer71 | frameshift_variant | Exon 2 of 3 | XP_011522598.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| USH1G | ENST00000614341.5 | c.832_851delTCGGACGAGGACAGCGTCTC | p.Ser278ProfsTer71 | frameshift_variant | Exon 2 of 3 | 1 | NM_173477.5 | ENSP00000480279.1 | ||
| USH1G | ENST00000579243.1 | n.*431_*450delTCGGACGAGGACAGCGTCTC | non_coding_transcript_exon_variant | Exon 2 of 3 | 2 | ENSP00000462568.1 | ||||
| USH1G | ENST00000579243.1 | n.*431_*450delTCGGACGAGGACAGCGTCTC | 3_prime_UTR_variant | Exon 2 of 3 | 2 | ENSP00000462568.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Usher syndrome type 1G Pathogenic:4
- -
- -
profound w/retinitis pigmentosum -
- -
Usher syndrome type 1 Other:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at