17-74919984-GGAGACGCTGTCCTCGTCCGA-G
Position:
Variant summary
Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate
The NM_173477.5(USH1G):c.832_851delTCGGACGAGGACAGCGTCTC(p.Ser278fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Genomes: not found (cov: 32)
Consequence
USH1G
NM_173477.5 frameshift
NM_173477.5 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.32
Genes affected
USH1G (HGNC:16356): (USH1 protein network component sans) This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 8 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.4 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-74919984-GGAGACGCTGTCCTCGTCCGA-G is Pathogenic according to our data. Variant chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 2916.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G is described in Lovd as [Pathogenic].
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
USH1G | NM_173477.5 | c.832_851delTCGGACGAGGACAGCGTCTC | p.Ser278fs | frameshift_variant | 2/3 | ENST00000614341.5 | NP_775748.2 | |
USH1G | NM_001282489.3 | c.523_542delTCGGACGAGGACAGCGTCTC | p.Ser175fs | frameshift_variant | 2/3 | NP_001269418.1 | ||
USH1G | XM_011524296.2 | c.523_542delTCGGACGAGGACAGCGTCTC | p.Ser175fs | frameshift_variant | 2/3 | XP_011522598.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
USH1G | ENST00000614341.5 | c.832_851delTCGGACGAGGACAGCGTCTC | p.Ser278fs | frameshift_variant | 2/3 | 1 | NM_173477.5 | ENSP00000480279.1 | ||
USH1G | ENST00000579243.1 | n.*431_*450delTCGGACGAGGACAGCGTCTC | non_coding_transcript_exon_variant | 2/3 | 2 | ENSP00000462568.1 | ||||
USH1G | ENST00000579243.1 | n.*431_*450delTCGGACGAGGACAGCGTCTC | 3_prime_UTR_variant | 2/3 | 2 | ENSP00000462568.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:4Other:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Usher syndrome type 1G Pathogenic:4
Pathogenic, criteria provided, single submitter | clinical testing | Mayo Clinic Laboratories, Mayo Clinic | Nov 28, 2016 | - - |
Pathogenic, no assertion criteria provided | literature only | OMIM | Mar 01, 2003 | - - |
Pathogenic, no assertion criteria provided | curation | GeneReviews | Jun 20, 2013 | - - |
Pathogenic, no assertion criteria provided | research | Hereditary Research Laboratory, Bethlehem University | Jun 04, 2016 | profound w/retinitis pigmentosum - |
Usher syndrome type 1 Other:1
not provided, no classification provided | literature only | GeneReviews | - | - - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at