NM_173477.5:c.832_851delTCGGACGAGGACAGCGTCTC

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_StrongPM2PP5_Moderate

The NM_173477.5(USH1G):​c.832_851delTCGGACGAGGACAGCGTCTC​(p.Ser278ProfsTer71) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

USH1G
NM_173477.5 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:4O:1

Conservation

PhyloP100: 9.32
Variant links:
Genes affected
USH1G (HGNC:16356): (USH1 protein network component sans) This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.4 CDS is truncated, and there are 2 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-74919984-GGAGACGCTGTCCTCGTCCGA-G is Pathogenic according to our data. Variant chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 2916.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
USH1GNM_173477.5 linkc.832_851delTCGGACGAGGACAGCGTCTC p.Ser278ProfsTer71 frameshift_variant Exon 2 of 3 ENST00000614341.5 NP_775748.2
USH1GNM_001282489.3 linkc.523_542delTCGGACGAGGACAGCGTCTC p.Ser175ProfsTer71 frameshift_variant Exon 2 of 3 NP_001269418.1 Q495M9B4DL95
USH1GXM_011524296.2 linkc.523_542delTCGGACGAGGACAGCGTCTC p.Ser175ProfsTer71 frameshift_variant Exon 2 of 3 XP_011522598.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
USH1GENST00000614341.5 linkc.832_851delTCGGACGAGGACAGCGTCTC p.Ser278ProfsTer71 frameshift_variant Exon 2 of 3 1 NM_173477.5 ENSP00000480279.1 Q495M9
USH1GENST00000579243.1 linkn.*431_*450delTCGGACGAGGACAGCGTCTC non_coding_transcript_exon_variant Exon 2 of 3 2 ENSP00000462568.1 J3KSN5
USH1GENST00000579243.1 linkn.*431_*450delTCGGACGAGGACAGCGTCTC 3_prime_UTR_variant Exon 2 of 3 2 ENSP00000462568.1 J3KSN5

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:4Other:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Usher syndrome type 1G Pathogenic:4
Jun 20, 2013
GeneReviews
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: curation

- -

Nov 28, 2016
Mayo Clinic Laboratories, Mayo Clinic
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Mar 01, 2003
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Jun 04, 2016
Hereditary Research Laboratory, Bethlehem University
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: research

profound w/retinitis pigmentosum -

Usher syndrome type 1 Other:1
-
GeneReviews
Significance: not provided
Review Status: no classification provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs397515345; hg19: chr17-72916079; API