chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G

Variant names:

• chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G
• rs397515345
• NM_173477.5:c.832_851delTCGGACGAGGACAGCGTCTC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_173477.5(USH1G):​c.832_851delTCGGACGAGGACAGCGTCTC​(p.Ser278ProfsTer71) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: USH1G NM_173477.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:4 O:1
• Conservation: PhyloP100: 9.32
• Publications: 6 publications found

Genes affected

USH1G (HGNC:16356): (USH1 protein network component sans) This gene encodes a protein that contains three ankyrin domains, a class I PDZ-binding motif and a sterile alpha motif. The encoded protein interacts with harmonin, which is associated with Usher syndrome type 1C. This protein plays a role in the development and maintenance of the auditory and visual systems and functions in the cohesion of hair bundles formed by inner ear sensory cells. Mutations in this gene are associated with Usher syndrome type 1G (USH1G). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

USH1G Gene-Disease associations (from GenCC):

• Usher syndrome type 1G

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Usher syndrome type 1

  Inheritance: Unknown, AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 17-74919984-GGAGACGCTGTCCTCGTCCGA-G is Pathogenic according to our data. Variant chr17-74919984-GGAGACGCTGTCCTCGTCCGA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 2916.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_173477.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	USH1G	NM_173477.5	MANE Select	c.832_851delTCGGACGAGGACAGCGTCTC	p.Ser278ProfsTer71	frameshift	Exon 2 of 3	NP_775748.2
	USH1G	NM_001282489.3		c.523_542delTCGGACGAGGACAGCGTCTC	p.Ser175ProfsTer71	frameshift	Exon 2 of 3	NP_001269418.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	USH1G	ENST00000614341.5	TSL:1 MANE Select	c.832_851delTCGGACGAGGACAGCGTCTC	p.Ser278ProfsTer71	frameshift	Exon 2 of 3	ENSP00000480279.1	Q495M9
	USH1G	ENST00000579243.1	TSL:2	n.*431_*450delTCGGACGAGGACAGCGTCTC		non_coding_transcript_exon	Exon 2 of 3	ENSP00000462568.1	J3KSN5
	USH1G	ENST00000579243.1	TSL:2	n.*431_*450delTCGGACGAGGACAGCGTCTC		3_prime_UTR	Exon 2 of 3	ENSP00000462568.1	J3KSN5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
4	-	-	Usher syndrome type 1G (4)
-	-	-	Usher syndrome type 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.3
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397515345; hg19: chr17-72916079;