17-80107630-TATATCACAGGCCTCGCCGA-C
Variant summary
Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PP4PVS1PM2
This summary comes from the ClinGen Evidence Repository: This variant, c.766_c.785delinsC (p.Tyr256ArgfsTer6), is a frameshift variant that is predicted to result in a premature termination codon, nonsense mediated decay, and lack of gene product, meeting PVS1. This is supported by the finding that a patient who is compound heterozygous for this variant and another null variant has no GAA cross-reactive material in cultured skin fibroblasts i.e. CRIM-negative (PMIDs 22252923, 25763511). This patient and one other meet the ClinGen LSD VCEP’s specifications for PP4. The first patient is compound heterozygous for the variant and c.2432delT (p.Leu811fsTer37) (PMID 25763511); the second is compound heterozygous for the variant and c.2014C>T (p.Arg672Trp) (PMID 9535769). The phase of the variants is unknown. In both cases, the in trans data will be used in the assessment of the second variant and was, therefore, not include here for PM3 in order to avoid a circular argument. Another patient has been reported to be compound heterozygous for the variant and c.-32-13T>G but was not included because the residual GAA activity was not reported (PMID 30564623). Finally, two siblings with adult onset Pompe disease have been reported to have the variant but the second variant and residual GAA activity were not provided (PMID 10206684). This variant is not in gnomAD v2.1.1, meeting PM2. There is a ClinVar entry for this variant (Variation ID: 188880, two star review status) with two submitters classifying the variant as pathogenic and one as likely pathogenic. In summary, this variant meets the criteria to be classified as pathogenic for Pompe disease. GAA-specific ACMG/AMP criteria applied, as specified by the ClinGen LSD VCEP: PVS1, PM2, PP4. LINK:https://erepo.genome.network/evrepo/ui/classification/CA274073/MONDO:0009290/010
Frequency
Consequence
NM_000152.5 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- glycogen storage disease IIInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), PanelApp Australia, ClinGen, G2P
- glycogen storage disease due to acid maltase deficiency, infantile onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- glycogen storage disease due to acid maltase deficiency, late-onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 11 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| GAA | NM_000152.5 | c.766_785delTATATCACAGGCCTCGCCGAinsC | p.Tyr256ArgfsTer6 | frameshift_variant, missense_variant | Exon 4 of 20 | ENST00000302262.8 | NP_000143.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| GAA | ENST00000302262.8 | c.766_785delTATATCACAGGCCTCGCCGAinsC | p.Tyr256ArgfsTer6 | frameshift_variant, missense_variant | Exon 4 of 20 | 1 | NM_000152.5 | ENSP00000305692.3 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 genome Cov.: 34
ClinVar
Submissions by phenotype
Glycogen storage disease, type II Pathogenic:6
Variant summary: GAA c.766_785delinsC (p.Tyr256ArgfsX6) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 251112 control chromosomes. c.766_785delinsC has been reported in the literature in individuals affected with Glycogen Storage Disease, Type 2 (Pompe Disease; eg. Beesley_1998, Huie_1998, Bali_2012). These data indicate that the variant is likely to be associated with disease. Five clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -
This variant, c.766_c.785delinsC (p.Tyr256ArgfsTer6), is a frameshift variant that is predicted to result in a premature termination codon, nonsense mediated decay, and lack of gene product, meeting PVS1. This is supported by the finding that a patient who is compound heterozygous for this variant and another null variant has no GAA cross-reactive material in cultured skin fibroblasts i.e. CRIM-negative (PMIDs 22252923, 25763511). This patient and one other meet the ClinGen LSD VCEP's specifications for PP4. The first patient is compound heterozygous for the variant and c.2432delT (p.Leu811fsTer37) (PMID 25763511); the second is compound heterozygous for the variant and c.2014C>T (p.Arg672Trp) (PMID 9535769). The phase of the variants is unknown. In both cases, the in trans data will be used in the assessment of the second variant and was, therefore, not include here for PM3 in order to avoid a circular argument. Another patient has been reported to be compound heterozygous for the variant and c.-32-13T>G but was not included because the residual GAA activity was not reported (PMID 30564623). Finally, two siblings with adult onset Pompe disease have been reported to have the variant but the second variant and residual GAA activity were not provided (PMID 10206684). This variant is not in gnomAD v2.1.1, meeting PM2. There is a ClinVar entry for this variant (Variation ID: 188880, two star review status) with two submitters classifying the variant as pathogenic and one as likely pathogenic. In summary, this variant meets the criteria to be classified as pathogenic for Pompe disease. GAA-specific ACMG/AMP criteria applied, as specified by the ClinGen LSD VCEP: PVS1, PM2, PP4. -
This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -
This sequence change creates a premature translational stop signal (p.Tyr256Serfs*6) in the GAA gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in GAA are known to be pathogenic (PMID: 18425781, 22252923). Information on the frequency of this variant in the gnomAD database is not available, as this variant may be reported differently in the database. This premature translational stop signal has been observed in individual(s) with glycogen storage disease (PMID: 10206684). For these reasons, this variant has been classified as Pathogenic. -
- -
- -
not provided Pathogenic:3
- -
- -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at