rs786204532

Variant names:

• chr17-80107630-TATATCACAGGCCTCGCCGA-C
• rs786204532
• NM_000152.5:c.766_785delTATATCACAGGCCTCGCCGAinsC

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PP4 PVS1 PM2

This summary comes from the ClinGen Evidence Repository: This variant, c.766_c.785delinsC (p.Tyr256ArgfsTer6), is a frameshift variant that is predicted to result in a premature termination codon, nonsense mediated decay, and lack of gene product, meeting PVS1. This is supported by the finding that a patient who is compound heterozygous for this variant and another null variant has no GAA cross-reactive material in cultured skin fibroblasts i.e. CRIM-negative (PMIDs 22252923, 25763511). This patient and one other meet the ClinGen LSD VCEP’s specifications for PP4. The first patient is compound heterozygous for the variant and c.2432delT (p.Leu811fsTer37) (PMID 25763511); the second is compound heterozygous for the variant and c.2014C>T (p.Arg672Trp) (PMID 9535769). The phase of the variants is unknown. In both cases, the in trans data will be used in the assessment of the second variant and was, therefore, not include here for PM3 in order to avoid a circular argument. Another patient has been reported to be compound heterozygous for the variant and c.-32-13T>G but was not included because the residual GAA activity was not reported (PMID 30564623). Finally, two siblings with adult onset Pompe disease have been reported to have the variant but the second variant and residual GAA activity were not provided (PMID 10206684). This variant is not in gnomAD v2.1.1, meeting PM2. There is a ClinVar entry for this variant (Variation ID: 188880, two star review status) with two submitters classifying the variant as pathogenic and one as likely pathogenic. In summary, this variant meets the criteria to be classified as pathogenic for Pompe disease. GAA-specific ACMG/AMP criteria applied, as specified by the ClinGen LSD VCEP: PVS1, PM2, PP4. LINK:https://erepo.genome.network/evrepo/ui/classification/CA274073/MONDO:0009290/010

• Frequency: Genomes: not found (cov: 34)
• Consequence: GAA NM_000152.5 frameshift, missense
• Clinical Significance: Pathogenic reviewed by expert panel P:10
• Conservation: PhyloP100: 9.85
• Publications: 1 publications found

Genes affected

GAA (HGNC:4065): (alpha glucosidase) This gene encodes lysosomal alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. The encoded preproprotein is proteolytically processed to generate multiple intermediate forms and the mature form of the enzyme. Defects in this gene are the cause of glycogen storage disease II, also known as Pompe's disease, which is an autosomal recessive disorder with a broad clinical spectrum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

GAA Gene-Disease associations (from GenCC):

• glycogen storage disease II

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine
• glycogen storage disease due to acid maltase deficiency, infantile onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• glycogen storage disease due to acid maltase deficiency, late-onset

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Specifications for GAA are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 11 ACMG points.

• PVS1: For more information check the summary or visit ClinGen Evidence Repository.
• PM2: For more information check the summary or visit ClinGen Evidence Repository.
• PP4: For more information check the summary or visit ClinGen Evidence Repository.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000152.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GAA	NM_000152.5	MANE Select	c.766_785delTATATCACAGGCCTCGCCGAinsC	p.Tyr256ArgfsTer6	frameshift missense	Exon 4 of 20	NP_000143.2	P10253
	GAA	NM_001079803.3		c.766_785delTATATCACAGGCCTCGCCGAinsC	p.Tyr256ArgfsTer6	frameshift missense	Exon 5 of 21	NP_001073271.1	P10253
	GAA	NM_001079804.3		c.766_785delTATATCACAGGCCTCGCCGAinsC	p.Tyr256ArgfsTer6	frameshift missense	Exon 4 of 20	NP_001073272.1	P10253

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GAA	ENST00000302262.8	TSL:1 MANE Select	c.766_785delTATATCACAGGCCTCGCCGAinsC	p.Tyr256ArgfsTer6	frameshift missense	Exon 4 of 20	ENSP00000305692.3	P10253
	GAA	ENST00000390015.7	TSL:1	c.766_785delTATATCACAGGCCTCGCCGAinsC	p.Tyr256ArgfsTer6	frameshift missense	Exon 5 of 21	ENSP00000374665.3	P10253
	GAA	ENST00000933406.1		c.766_785delTATATCACAGGCCTCGCCGAinsC	p.Tyr256ArgfsTer6	frameshift missense	Exon 4 of 20	ENSP00000603465.1

Frequencies

GnomAD3 genomes Cov.: 34

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 34

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
6	-	-	Glycogen storage disease, type II (6)
4	-	-	not provided (4)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=2/198	disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs786204532; hg19: chr17-78081429;