rs786204532

Variant summary

Our verdict is Pathogenic. The variant received 11 ACMG points: 11P and 0B. PP4PVS1PM2

This summary comes from the ClinGen Evidence Repository: This variant, c.766_c.785delinsC (p.Tyr256ArgfsTer6), is a frameshift variant that is predicted to result in a premature termination codon, nonsense mediated decay, and lack of gene product, meeting PVS1. This is supported by the finding that a patient who is compound heterozygous for this variant and another null variant has no GAA cross-reactive material in cultured skin fibroblasts i.e. CRIM-negative (PMIDs 22252923, 25763511). This patient and one other meet the ClinGen LSD VCEP’s specifications for PP4. The first patient is compound heterozygous for the variant and c.2432delT (p.Leu811fsTer37) (PMID 25763511); the second is compound heterozygous for the variant and c.2014C>T (p.Arg672Trp) (PMID 9535769). The phase of the variants is unknown. In both cases, the in trans data will be used in the assessment of the second variant and was, therefore, not include here for PM3 in order to avoid a circular argument. Another patient has been reported to be compound heterozygous for the variant and c.-32-13T>G but was not included because the residual GAA activity was not reported (PMID 30564623). Finally, two siblings with adult onset Pompe disease have been reported to have the variant but the second variant and residual GAA activity were not provided (PMID 10206684). This variant is not in gnomAD v2.1.1, meeting PM2. There is a ClinVar entry for this variant (Variation ID: 188880, two star review status) with two submitters classifying the variant as pathogenic and one as likely pathogenic. In summary, this variant meets the criteria to be classified as pathogenic for Pompe disease. GAA-specific ACMG/AMP criteria applied, as specified by the ClinGen LSD VCEP: PVS1, PM2, PP4. LINK:https://erepo.genome.network/evrepo/ui/classification/CA274073/MONDO:0009290/010

Frequency

Genomes: not found (cov: 34)

Consequence

GAA
NM_000152.5 frameshift, missense

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:9

Conservation

PhyloP100: 9.85

Publications

1 publications found
Variant links:
Genes affected
GAA (HGNC:4065): (alpha glucosidase) This gene encodes lysosomal alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. The encoded preproprotein is proteolytically processed to generate multiple intermediate forms and the mature form of the enzyme. Defects in this gene are the cause of glycogen storage disease II, also known as Pompe's disease, which is an autosomal recessive disorder with a broad clinical spectrum. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
GAA Gene-Disease associations (from GenCC):
  • glycogen storage disease II
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), PanelApp Australia, ClinGen, G2P
  • glycogen storage disease due to acid maltase deficiency, infantile onset
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
  • glycogen storage disease due to acid maltase deficiency, late-onset
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 11 ACMG points.

PVS1
For more information check the summary or visit ClinGen Evidence Repository.
PM2
For more information check the summary or visit ClinGen Evidence Repository.
PP4
For more information check the summary or visit ClinGen Evidence Repository.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
GAANM_000152.5 linkc.766_785delTATATCACAGGCCTCGCCGAinsC p.Tyr256ArgfsTer6 frameshift_variant, missense_variant Exon 4 of 20 ENST00000302262.8 NP_000143.2 P10253

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
GAAENST00000302262.8 linkc.766_785delTATATCACAGGCCTCGCCGAinsC p.Tyr256ArgfsTer6 frameshift_variant, missense_variant Exon 4 of 20 1 NM_000152.5 ENSP00000305692.3 P10253

Frequencies

GnomAD3 genomes
Cov.:
34
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
34

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:9
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Glycogen storage disease, type II Pathogenic:6
Aug 08, 2022
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant summary: GAA c.766_785delinsC (p.Tyr256ArgfsX6) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant was absent in 251112 control chromosomes. c.766_785delinsC has been reported in the literature in individuals affected with Glycogen Storage Disease, Type 2 (Pompe Disease; eg. Beesley_1998, Huie_1998, Bali_2012). These data indicate that the variant is likely to be associated with disease. Five clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories classified the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Oct 06, 2020
ClinGen Lysosomal Storage Disorder Variant Curation Expert Panel
Significance:Pathogenic
Review Status:reviewed by expert panel
Collection Method:curation

This variant, c.766_c.785delinsC (p.Tyr256ArgfsTer6), is a frameshift variant that is predicted to result in a premature termination codon, nonsense mediated decay, and lack of gene product, meeting PVS1. This is supported by the finding that a patient who is compound heterozygous for this variant and another null variant has no GAA cross-reactive material in cultured skin fibroblasts i.e. CRIM-negative (PMIDs 22252923, 25763511). This patient and one other meet the ClinGen LSD VCEP's specifications for PP4. The first patient is compound heterozygous for the variant and c.2432delT (p.Leu811fsTer37) (PMID 25763511); the second is compound heterozygous for the variant and c.2014C>T (p.Arg672Trp) (PMID 9535769). The phase of the variants is unknown. In both cases, the in trans data will be used in the assessment of the second variant and was, therefore, not include here for PM3 in order to avoid a circular argument. Another patient has been reported to be compound heterozygous for the variant and c.-32-13T>G but was not included because the residual GAA activity was not reported (PMID 30564623). Finally, two siblings with adult onset Pompe disease have been reported to have the variant but the second variant and residual GAA activity were not provided (PMID 10206684). This variant is not in gnomAD v2.1.1, meeting PM2. There is a ClinVar entry for this variant (Variation ID: 188880, two star review status) with two submitters classifying the variant as pathogenic and one as likely pathogenic. In summary, this variant meets the criteria to be classified as pathogenic for Pompe disease. GAA-specific ACMG/AMP criteria applied, as specified by the ClinGen LSD VCEP: PVS1, PM2, PP4. -

Aug 18, 2014
Counsyl
Significance:Likely pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

This submission and the accompanying classification are no longer maintained by the submitter. For more information on current observations and classification, please contact variantquestions@myriad.com. -

Oct 09, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This sequence change creates a premature translational stop signal (p.Tyr256Serfs*6) in the GAA gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in GAA are known to be pathogenic (PMID: 18425781, 22252923). Information on the frequency of this variant in the gnomAD database is not available, as this variant may be reported differently in the database. This premature translational stop signal has been observed in individual(s) with glycogen storage disease (PMID: 10206684). For these reasons, this variant has been classified as Pathogenic. -

Feb 12, 2024
Fulgent Genetics, Fulgent Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Sep 12, 2023
Baylor Genetics
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

not provided Pathogenic:3
Mar 25, 2016
Eurofins Ntd Llc (ga)
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

May 19, 2022
Revvity Omics, Revvity
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Feb 11, 2022
AiLife Diagnostics, AiLife Diagnostics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.8
Mutation Taster
=2/198
disease causing (fs/PTC)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs786204532; hg19: chr17-78081429; API