18-3188915-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGTCTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT

Variant names:

• chr18-3188915-A-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT
• rs745347160
• NM_003803.4:c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_003803.4(MYOM1):​c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG​(p.Gln201_Ser202insThrThrAlaSerLysGlnSerThrAlaSerLysGln) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 30)
  • Exomes 𝑓: 0.0000034 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MYOM1 NM_003803.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.254

Genes affected

MYOM1 (HGNC:7613): (myomesin 1) The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_003803.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYOM1	NM_003803.4	c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG	p.Gln201_Ser202insThrThrAlaSerLysGlnSerThrAlaSerLysGln	conservative_inframe_insertion	Exon 4 of 38	ENST00000356443.9	NP_003794.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYOM1	ENST00000356443.9	c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG	p.Gln201_Ser202insThrThrAlaSerLysGlnSerThrAlaSerLysGln	conservative_inframe_insertion	Exon 4 of 38	1	NM_003803.4	ENSP00000348821.4
MYOM1	ENST00000261606.11	c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG	p.Gln201_Ser202insThrThrAlaSerLysGlnSerThrAlaSerLysGln	conservative_inframe_insertion	Exon 4 of 37	1		ENSP00000261606.7

Frequencies

GnomAD3 genomes Cov.: 30

GnomAD3 exomes AF: 0.00000803 AC: 2 AN: 249206 Hom.: 0 AF XY: 0.00000740 AC XY: 1 AN XY: 135198

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.0000994

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.0000327

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000342 AC: 5 AN: 1461234 Hom.: 0 Cov.: 32 AF XY: 0.00000413 AC XY: 3 AN XY: 726904

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.0000384

Gnomad4 EAS exome AF: 0.0000252

Gnomad4 SAS exome AF: 0.0000232

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Cov.: 30

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypertrophic cardiomyopathy Uncertain:1

Jul 26, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.568_603dup, results in the insertion of 12 amino acid(s) to the MYOM1 protein (p.Thr190_Gln201dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals affected with MYOM1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs745347160; hg19: chr18-3188913;