chr18-3188915-A-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_003803.4(MYOM1):c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG(p.Gln201_Ser202insThrThrAlaSerLysGlnSerThrAlaSerLysGln) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_003803.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| MYOM1 | ENST00000356443.9 | c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG | p.Gln201_Ser202insThrThrAlaSerLysGlnSerThrAlaSerLysGln | conservative_inframe_insertion | Exon 4 of 38 | 1 | NM_003803.4 | ENSP00000348821.4 | ||
| MYOM1 | ENST00000261606.11 | c.568_603dupACCACGGCATCTAAGCAGTCCACGGCATCCAAGCAG | p.Gln201_Ser202insThrThrAlaSerLysGlnSerThrAlaSerLysGln | conservative_inframe_insertion | Exon 4 of 37 | 1 | ENSP00000261606.7 |
Frequencies
GnomAD3 genomes Cov.: 30
GnomAD2 exomes AF: 0.00000803 AC: 2AN: 249206 AF XY: 0.00000740 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000342 AC: 5AN: 1461234Hom.: 0 Cov.: 32 AF XY: 0.00000413 AC XY: 3AN XY: 726904 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 30
ClinVar
Submissions by phenotype
Hypertrophic cardiomyopathy Uncertain:1
This variant, c.568_603dup, results in the insertion of 12 amino acid(s) to the MYOM1 protein (p.Thr190_Gln201dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals affected with MYOM1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at