rs745347160

chr18-3188915-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT-Achr18-3188915-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGTCTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM4 BP6_Moderate

The NM_003803.4(MYOM1):c.568_603del(p.Thr190_Gln201del) variant causes a inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000714 in 149,766 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.00071 (0 hom., cov: 30)
  • Exomes 𝑓: 0.000081 (1 hom.)
  • Failed GnomAD Quality Control
• Consequence: MYOM1 NM_003803.4 inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 3.10

Genes affected

MYOM1 (HGNC:7613): (myomesin 1) The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003803.4.
• BP6: Variant 18-3188915-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT-A is Benign according to our data. Variant chr18-3188915-ACTGCTTGGATGCCGTGGACTGCTTAGATGCCGTGGT-A is described in ClinVar as [Likely_benign]. Clinvar id is 525090.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
MYOM1	NM_003803.4	c.568_603del	p.Thr190_Gln201del	inframe_deletion	4/38	ENST00000356443.9

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
MYOM1	ENST00000356443.9	c.568_603del	p.Thr190_Gln201del	inframe_deletion	4/38	1	NM_003803.4	P2
MYOM1	ENST00000261606.11	c.568_603del	p.Thr190_Gln201del	inframe_deletion	4/37	1		A2

Frequencies

GnomAD3 genomes AF: 0.000715 AC: 107 AN: 149648 Hom.: 0 Cov.: 30

Gnomad AFR AF: 0.00234

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000669

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.000486

GnomAD3 exomes AF: 0.000197 AC: 49 AN: 249206 Hom.: 0 AF XY: 0.000111 AC XY: 15 AN XY: 135198

Gnomad AFR exome AF: 0.00265

Gnomad AMR exome AF: 0.000203

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.000165

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000808 AC: 118 AN: 1461214 Hom.: 1 AF XY: 0.0000674 AC XY: 49 AN XY: 726892

Gnomad4 AFR exome AF: 0.00281

Gnomad4 AMR exome AF: 0.000179

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000232

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.00e-7

Gnomad4 OTH exome AF: 0.000215

GnomAD4 genome AF: 0.000714 AC: 107 AN: 149766 Hom.: 0 Cov.: 30 AF XY: 0.000644 AC XY: 47 AN XY: 73016

Gnomad4 AFR AF: 0.00233

Gnomad4 AMR AF: 0.000668

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000148

Gnomad4 OTH AF: 0.000482

Alfa AF: 0.0000843 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypertrophic cardiomyopathy Benign:1

Likely benign, criteria provided, single submitter

clinical testing

Invitae

Dec 01, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs745347160; hg19: chr18-3188913;