19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_023035.3(CACNA1A):c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG(p.Pro973AlafsTer89) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G972G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_023035.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- episodic ataxia type 2Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- undetermined early-onset epileptic encephalopathyInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
- developmental and epileptic encephalopathy, 42Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- migraine, familial hemiplegic, 1Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- spinocerebellar ataxia type 6Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
- benign paroxysmal torticollis of infancyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- familial or sporadic hemiplegic migraineInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Lennox-Gastaut syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_023035.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CACNA1A | NM_001127222.2 | MANE Select | c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro969AlafsTer89 | frameshift | Exon 19 of 47 | NP_001120694.1 | ||
| CACNA1A | NM_001127221.2 | MANE Plus Clinical | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970AlafsTer89 | frameshift | Exon 19 of 47 | NP_001120693.1 | ||
| CACNA1A | NM_023035.3 | c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro973AlafsTer89 | frameshift | Exon 19 of 48 | NP_075461.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CACNA1A | ENST00000360228.11 | TSL:1 MANE Select | c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro969AlafsTer89 | frameshift | Exon 19 of 47 | ENSP00000353362.5 | ||
| CACNA1A | ENST00000638009.2 | TSL:1 MANE Plus Clinical | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970AlafsTer89 | frameshift | Exon 19 of 47 | ENSP00000489913.1 | ||
| CACNA1A | ENST00000638029.1 | TSL:5 | c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro973AlafsTer89 | frameshift | Exon 19 of 48 | ENSP00000489829.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at