chr19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G

Variant names:

• chr19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G
• rs1555755909
• NM_001127222.2:c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The ENST00000637769.1(CACNA1A):​c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG​(p.Pro970AlafsTer89) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G969G) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CACNA1A ENST00000637769.1 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2 O:1
• Conservation: PhyloP100: 2.76
• Publications: 0 publications found

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

CACNA1A Gene-Disease associations (from GenCC):

• episodic ataxia type 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• undetermined early-onset epileptic encephalopathy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, Illumina
• developmental and epileptic encephalopathy, 42

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• migraine, familial hemiplegic, 1

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• spinocerebellar ataxia type 6

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• benign paroxysmal torticollis of infancy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial or sporadic hemiplegic migraine

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Lennox-Gastaut syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is Pathogenic according to our data. Variant chr19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 476244.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000637769.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1A	NM_001127222.2	MANE Select	c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro969AlafsTer89	frameshift	Exon 19 of 47	NP_001120694.1
	CACNA1A	NM_001127221.2	MANE Plus Clinical	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift	Exon 19 of 47	NP_001120693.1
	CACNA1A	NM_023035.3		c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro973AlafsTer89	frameshift	Exon 19 of 48	NP_075461.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CACNA1A	ENST00000360228.11	TSL:1 MANE Select	c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro969AlafsTer89	frameshift	Exon 19 of 47	ENSP00000353362.5
	CACNA1A	ENST00000638009.2	TSL:1 MANE Plus Clinical	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift	Exon 19 of 47	ENSP00000489913.1
	CACNA1A	ENST00000638029.1	TSL:5	c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro973AlafsTer89	frameshift	Exon 19 of 48	ENSP00000489829.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Episodic ataxia type 2;C4310716:Developmental and epileptic encephalopathy, 42 (1)
1	-	-	not provided (1)
-	-	-	Spinocerebellar ataxia type 6;C1720416:Episodic ataxia type 2;C1832884:Migraine, familial hemiplegic, 1;CN239232:Early Infantile Epileptic Encephalopathy, Autosomal Dominant (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.8
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555755909; hg19: chr19-13409517;