rs1555755909
Positions:
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_001127222.2(CACNA1A):c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG(p.Pro969fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
CACNA1A
NM_001127222.2 frameshift
NM_001127222.2 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 2.76
Genes affected
CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is Pathogenic according to our data. Variant chr19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 476244.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CACNA1A | NM_001127222.2 | c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro969fs | frameshift_variant | 19/47 | ENST00000360228.11 | NP_001120694.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CACNA1A | ENST00000360228.11 | c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro969fs | frameshift_variant | 19/47 | 1 | NM_001127222.2 | ENSP00000353362.5 | ||
CACNA1A | ENST00000638029.1 | c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro973fs | frameshift_variant | 19/48 | 5 | ENSP00000489829.1 | |||
CACNA1A | ENST00000573710.7 | c.2910_2935delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro971fs | frameshift_variant | 19/47 | 5 | ENSP00000460092.3 | |||
CACNA1A | ENST00000635727.1 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/47 | 5 | ENSP00000490001.1 | |||
CACNA1A | ENST00000637769.1 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/47 | 1 | ENSP00000489778.1 | |||
CACNA1A | ENST00000636012.1 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/46 | 5 | ENSP00000490223.1 | |||
CACNA1A | ENST00000637736.1 | c.2766_2791delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro923fs | frameshift_variant | 18/46 | 5 | ENSP00000489861.1 | |||
CACNA1A | ENST00000636389.1 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/47 | 5 | ENSP00000489992.1 | |||
CACNA1A | ENST00000637432.1 | c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro973fs | frameshift_variant | 19/48 | 5 | ENSP00000490617.1 | |||
CACNA1A | ENST00000636549.1 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/48 | 5 | ENSP00000490578.1 | |||
CACNA1A | ENST00000637927.1 | c.2910_2935delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro971fs | frameshift_variant | 19/47 | 5 | ENSP00000489715.1 | |||
CACNA1A | ENST00000635895.1 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/47 | 5 | ENSP00000490323.1 | |||
CACNA1A | ENST00000638009.2 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/47 | 1 | ENSP00000489913.1 | |||
CACNA1A | ENST00000637276.1 | c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG | p.Pro970fs | frameshift_variant | 19/46 | 5 | ENSP00000489777.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2Other:1
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Episodic ataxia type 2;C4310716:Developmental and epileptic encephalopathy, 42 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | May 07, 2019 | The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in CACNA1A are known to be pathogenic (PMID: 10371528, 19486177, 25735478, 27250579). This variant has not been reported in the literature in individuals with CACNA1A-related conditions. ClinVar contains an entry for this variant (Variation ID: 476244). This sequence change creates a premature translational stop signal (p.Pro970Alafs*89) in the CACNA1A gene. It is expected to result in an absent or disrupted protein product. - |
not provided Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories | May 16, 2017 | - - |
Spinocerebellar ataxia type 6;C1720416:Episodic ataxia type 2;C1832884:Migraine, familial hemiplegic, 1;CN239232:Early Infantile Epileptic Encephalopathy, Autosomal Dominant Other:1
not provided, no classification provided | phenotyping only | GenomeConnect - Brain Gene Registry | - | Variant interpreted as Pathogenic and reported on 05-09-2019 by Lab or GTR ID 500031. Assertions are reported exactly as they appear on the patient provided laboratory report. GenomeConnect does not attempt to reinterpret the variant. The IDDRC-CTSA National Brain Gene Registry (BGR) is a study funded by the U.S. National Center for Advancing Translational Sciences (NCATS) and includes 13 Intellectual and Developmental Disability Research Center (IDDRC) institutions. The study is led by Principal Investigator John Constantino MD PhD from Washington University. The BGR is a data commons of gene variants paired with subject clinical information. This database helps scientists learn more about genetic changes and their impact on the brain and behavior. Participation in the Brain Gene Registry requires participation in GenomeConnect. More information about the Brain Gene Registry can be found on the study website - https://braingeneregistry.wustl.edu/. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at