rs1555755909

Variant names:

• chr19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G
• rs1555755909
• NM_001127222.2:c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001127222.2(CACNA1A):​c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG​(p.Pro969AlafsTer89) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CACNA1A NM_001127222.2 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2 O:1
• Conservation: PhyloP100: 2.76

Genes affected

CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is Pathogenic according to our data. Variant chr19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 476244.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CACNA1A	NM_001127222.2	c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro969AlafsTer89	frameshift_variant	Exon 19 of 47	ENST00000360228.11	NP_001120694.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CACNA1A	ENST00000360228.11	c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro969AlafsTer89	frameshift_variant	Exon 19 of 47	1	NM_001127222.2	ENSP00000353362.5
CACNA1A	ENST00000638029.1	c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro973AlafsTer89	frameshift_variant	Exon 19 of 48	5		ENSP00000489829.1
CACNA1A	ENST00000573710.7	c.2910_2935delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro971AlafsTer89	frameshift_variant	Exon 19 of 47	5		ENSP00000460092.3
CACNA1A	ENST00000635727.1	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 47	5		ENSP00000490001.1
CACNA1A	ENST00000637769.1	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 47	1		ENSP00000489778.1
CACNA1A	ENST00000636012.1	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 46	5		ENSP00000490223.1
CACNA1A	ENST00000637736.1	c.2766_2791delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro923AlafsTer89	frameshift_variant	Exon 18 of 46	5		ENSP00000489861.1
CACNA1A	ENST00000636389.1	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 47	5		ENSP00000489992.1
CACNA1A	ENST00000637432.1	c.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro973AlafsTer89	frameshift_variant	Exon 19 of 48	5		ENSP00000490617.1
CACNA1A	ENST00000636549.1	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 48	5		ENSP00000490578.1
CACNA1A	ENST00000637927.1	c.2910_2935delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro971AlafsTer89	frameshift_variant	Exon 19 of 47	5		ENSP00000489715.1
CACNA1A	ENST00000635895.1	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 47	5		ENSP00000490323.1
CACNA1A	ENST00000638009.2	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 47	1		ENSP00000489913.1
CACNA1A	ENST00000637276.1	c.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG	p.Pro970AlafsTer89	frameshift_variant	Exon 19 of 46	5		ENSP00000489777.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Episodic ataxia type 2;C4310716:Developmental and epileptic encephalopathy, 42 Pathogenic:1

May 07, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in CACNA1A are known to be pathogenic (PMID: 10371528, 19486177, 25735478, 27250579). This variant has not been reported in the literature in individuals with CACNA1A-related conditions. ClinVar contains an entry for this variant (Variation ID: 476244). This sequence change creates a premature translational stop signal (p.Pro970Alafs*89) in the CACNA1A gene. It is expected to result in an absent or disrupted protein product. -

not provided Pathogenic:1

May 16, 2017

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Spinocerebellar ataxia type 6;C1720416:Episodic ataxia type 2;C1832884:Migraine, familial hemiplegic, 1;CN239232:Early Infantile Epileptic Encephalopathy, Autosomal Dominant Other:1

-

GenomeConnect - Brain Gene Registry

Significance: not provided

Review Status: no classification provided

Collection Method: phenotyping only

Variant interpreted as Pathogenic and reported on 05-09-2019 by Lab or GTR ID 500031. Assertions are reported exactly as they appear on the patient provided laboratory report. GenomeConnect does not attempt to reinterpret the variant. The IDDRC-CTSA National Brain Gene Registry (BGR) is a study funded by the U.S. National Center for Advancing Translational Sciences (NCATS) and includes 13 Intellectual and Developmental Disability Research Center (IDDRC) institutions. The study is led by Principal Investigator John Constantino MD PhD from Washington University. The BGR is a data commons of gene variants paired with subject clinical information. This database helps scientists learn more about genetic changes and their impact on the brain and behavior. Participation in the Brain Gene Registry requires participation in GenomeConnect. More information about the Brain Gene Registry can be found on the study website - https://braingeneregistry.wustl.edu/. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555755909; hg19: chr19-13409517;