rs1555755909

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_001127222.2(CACNA1A):​c.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG​(p.Pro969AlafsTer89) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CACNA1A
NM_001127222.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:2O:1

Conservation

PhyloP100: 2.76
Variant links:
Genes affected
CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is Pathogenic according to our data. Variant chr19-13298703-GCCCTCCGCTCCGCCTTGTCCTCCGGA-G is described in ClinVar as [Pathogenic]. Clinvar id is 476244.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CACNA1ANM_001127222.2 linkc.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro969AlafsTer89 frameshift_variant Exon 19 of 47 ENST00000360228.11 NP_001120694.1 O00555-8

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CACNA1AENST00000360228.11 linkc.2904_2929delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro969AlafsTer89 frameshift_variant Exon 19 of 47 1 NM_001127222.2 ENSP00000353362.5 O00555-8
CACNA1AENST00000638029.1 linkc.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro973AlafsTer89 frameshift_variant Exon 19 of 48 5 ENSP00000489829.1 A0A087WW63
CACNA1AENST00000573710.7 linkc.2910_2935delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro971AlafsTer89 frameshift_variant Exon 19 of 47 5 ENSP00000460092.3 A0A1C7CYY9
CACNA1AENST00000635727.1 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 47 5 ENSP00000490001.1 A0A1B0GU81
CACNA1AENST00000637769.1 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 47 1 ENSP00000489778.1 A0A1B0GTN7
CACNA1AENST00000636012.1 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 46 5 ENSP00000490223.1 A0A1B0GUS3
CACNA1AENST00000637736.1 linkc.2766_2791delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro923AlafsTer89 frameshift_variant Exon 18 of 46 5 ENSP00000489861.1 A0A1B0GTW2
CACNA1AENST00000636389.1 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 47 5 ENSP00000489992.1 A0A1B0GU74
CACNA1AENST00000637432.1 linkc.2916_2941delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro973AlafsTer89 frameshift_variant Exon 19 of 48 5 ENSP00000490617.1 O00555-2
CACNA1AENST00000636549.1 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 48 5 ENSP00000490578.1 B5TYJ1
CACNA1AENST00000637927.1 linkc.2910_2935delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro971AlafsTer89 frameshift_variant Exon 19 of 47 5 ENSP00000489715.1 A0A1B0GTI4
CACNA1AENST00000635895.1 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 47 5 ENSP00000490323.1 A0A384DVW2
CACNA1AENST00000638009.2 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 47 1 ENSP00000489913.1 O00555-3
CACNA1AENST00000637276.1 linkc.2907_2932delTCCGGAGGACAAGGCGGAGCGGAGGG p.Pro970AlafsTer89 frameshift_variant Exon 19 of 46 5 ENSP00000489777.1 O00555-5

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2Other:1
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Episodic ataxia type 2;C4310716:Developmental and epileptic encephalopathy, 42 Pathogenic:1
May 07, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in CACNA1A are known to be pathogenic (PMID: 10371528, 19486177, 25735478, 27250579). This variant has not been reported in the literature in individuals with CACNA1A-related conditions. ClinVar contains an entry for this variant (Variation ID: 476244). This sequence change creates a premature translational stop signal (p.Pro970Alafs*89) in the CACNA1A gene. It is expected to result in an absent or disrupted protein product. -

not provided Pathogenic:1
May 16, 2017
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Spinocerebellar ataxia type 6;C1720416:Episodic ataxia type 2;C1832884:Migraine, familial hemiplegic, 1;CN239232:Early Infantile Epileptic Encephalopathy, Autosomal Dominant Other:1
-
GenomeConnect - Brain Gene Registry
Significance: not provided
Review Status: no classification provided
Collection Method: phenotyping only

Variant interpreted as Pathogenic and reported on 05-09-2019 by Lab or GTR ID 500031. Assertions are reported exactly as they appear on the patient provided laboratory report. GenomeConnect does not attempt to reinterpret the variant. The IDDRC-CTSA National Brain Gene Registry (BGR) is a study funded by the U.S. National Center for Advancing Translational Sciences (NCATS) and includes 13 Intellectual and Developmental Disability Research Center (IDDRC) institutions. The study is led by Principal Investigator John Constantino MD PhD from Washington University. The BGR is a data commons of gene variants paired with subject clinical information. This database helps scientists learn more about genetic changes and their impact on the brain and behavior. Participation in the Brain Gene Registry requires participation in GenomeConnect. More information about the Brain Gene Registry can be found on the study website - https://braingeneregistry.wustl.edu/. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555755909; hg19: chr19-13409517; API