19-13299295-C-CACTGGTCCGCTGCTCCCACACGGACTTG

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001127222.2(CACNA1A):​c.2310_2337dupCAAGTCCGTGTGGGAGCAGCGGACCAGT​(p.Glu780fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CACNA1A
NM_001127222.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 0.0650
Variant links:
Genes affected
CACNA1A (HGNC:1388): (calcium voltage-gated channel subunit alpha1 A) Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 19-13299295-C-CACTGGTCCGCTGCTCCCACACGGACTTG is Pathogenic according to our data. Variant chr19-13299295-C-CACTGGTCCGCTGCTCCCACACGGACTTG is described in ClinVar as [Pathogenic]. Clinvar id is 377185.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
CACNA1ANM_001127222.2 linkuse as main transcriptc.2310_2337dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu780fs frameshift_variant 19/47 ENST00000360228.11 NP_001120694.1 O00555-8

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
CACNA1AENST00000360228.11 linkuse as main transcriptc.2310_2337dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu780fs frameshift_variant 19/471 NM_001127222.2 ENSP00000353362.5 O00555-8
CACNA1AENST00000638029.1 linkuse as main transcriptc.2322_2349dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu784fs frameshift_variant 19/485 ENSP00000489829.1 A0A087WW63
CACNA1AENST00000573710.7 linkuse as main transcriptc.2316_2343dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu782fs frameshift_variant 19/475 ENSP00000460092.3 A0A1C7CYY9
CACNA1AENST00000635727.1 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/475 ENSP00000490001.1 A0A1B0GU81
CACNA1AENST00000637769.1 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/471 ENSP00000489778.1 A0A1B0GTN7
CACNA1AENST00000636012.1 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/465 ENSP00000490223.1 A0A1B0GUS3
CACNA1AENST00000637736.1 linkuse as main transcriptc.2172_2199dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu734fs frameshift_variant 18/465 ENSP00000489861.1 A0A1B0GTW2
CACNA1AENST00000636389.1 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/475 ENSP00000489992.1 A0A1B0GU74
CACNA1AENST00000637432.1 linkuse as main transcriptc.2322_2349dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu784fs frameshift_variant 19/485 ENSP00000490617.1 O00555-2
CACNA1AENST00000636549.1 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/485 ENSP00000490578.1 B5TYJ1
CACNA1AENST00000637927.1 linkuse as main transcriptc.2316_2343dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu782fs frameshift_variant 19/475 ENSP00000489715.1 A0A1B0GTI4
CACNA1AENST00000635895.1 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/475 ENSP00000490323.1 A0A384DVW2
CACNA1AENST00000638009.2 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/471 ENSP00000489913.1 O00555-3
CACNA1AENST00000637276.1 linkuse as main transcriptc.2313_2340dupCAAGTCCGTGTGGGAGCAGCGGACCAGT p.Glu781fs frameshift_variant 19/465 ENSP00000489777.1 O00555-5

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
32
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingCenter for Pediatric Genomic Medicine, Children's Mercy Hospital and ClinicsAug 29, 2016- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1057520154; hg19: chr19-13410109; API