19-1491256-GGCGCGTCGGGGCCATGGACGGCCTGAGGCA-G

Position:

• chr19-1491256-GGCGCGTCGGGGCCATGGACGGCCTGAGGCA-G

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_138393.4(REEP6):​c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT​(p.Met1_Val8del) variant causes a start lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: REEP6 NM_138393.4 start_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.92

Genes affected

REEP6 (HGNC:30078): (receptor accessory protein 6) The protein encoded by this gene may be involved in the transport of receptors from the endoplasmic reticulum (ER) to the cell surface. The encoded protein may also play a role in regulating ER membrane structure. This gene is required for the proper development of retinal rods and photoreceptors, with defects in this gene being associated with retinitis pigmentosa 77. [provided by RefSeq, May 2017]

REEP6 (HGNC:):

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Start lost variant, no new inframe start found.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
REEP6	NM_001329556.3	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT	p.Met1_Val8del	start_lost, conservative_inframe_deletion	1/6	ENST00000395479.10	NP_001316485.1
REEP6	NM_138393.4	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT	p.Met1_Val8del	start_lost, conservative_inframe_deletion	1/5	ENST00000233596.8	NP_612402.1
REEP6	NM_001329556.3	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT		5_prime_UTR_variant	1/6	ENST00000395479.10	NP_001316485.1
REEP6	NM_138393.4	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT		5_prime_UTR_variant	1/5	ENST00000233596.8	NP_612402.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
REEP6	ENST00000395479.10	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT	p.Met1_Val8del	start_lost, conservative_inframe_deletion	1/6	3	NM_001329556.3	ENSP00000378861.5
REEP6	ENST00000233596.8	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT	p.Met1_Val8del	start_lost, conservative_inframe_deletion	1/5	1	NM_138393.4	ENSP00000233596.2
REEP6	ENST00000395479	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT		5_prime_UTR_variant	1/6	3	NM_001329556.3	ENSP00000378861.5
REEP6	ENST00000233596	c.-7_23delCGGGGCCATGGACGGCCTGAGGCAGCGCGT		5_prime_UTR_variant	1/5	1	NM_138393.4	ENSP00000233596.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AC0;AS_VQSR AF: 0.00 AC: 0 AN: 1307158 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 642998

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Jun 24, 2022

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant disrupts a region of the REEP6 protein in which other variant(s) (p.Glu75Lys) have been observed in individuals with REEP6-related conditions (PMID: 28369466; Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. This variant has not been reported in the literature in individuals affected with REEP6-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change affects the initiator methionine of the REEP6 mRNA. The next in-frame methionine is located at codon 124. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-1491255;