19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-CGGCGGCGGCCGCCGCGCGGATTGGGCGGCGGCCGCCGCGCGGATTG

Variant names:

• chr19-18606603-C-CGGCGGCGGCCGCCGCGCGGATTG
• rs137853929
• NM_004750.5:c.31_53dupCAATCCGCGCGGCGGCCGCCGCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_004750.5(CRLF1):​c.31_53dupCAATCCGCGCGGCGGCCGCCGCC​(p.Leu19AsnfsTer32) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000105 in 952,378 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 29)
  • Exomes 𝑓: 0.0000010 (0 hom.)
• Consequence: CRLF1 NM_004750.5 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.0670
• Publications: 0 publications found

Genes affected

CRLF1 (HGNC:2364): (cytokine receptor like factor 1) This gene encodes a member of the cytokine type I receptor family. The protein forms a secreted complex with cardiotrophin-like cytokine factor 1 and acts on cells expressing ciliary neurotrophic factor receptors. The complex can promote survival of neuronal cells. Mutations in this gene result in Crisponi syndrome and cold-induced sweating syndrome. [provided by RefSeq, Oct 2009]

CRLF1 Gene-Disease associations (from GenCC):

• Cold-induced sweating syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• cold-induced sweating syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• idiopathic achalasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 23 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CRLF1	NM_004750.5	c.31_53dupCAATCCGCGCGGCGGCCGCCGCC	p.Leu19AsnfsTer32	frameshift_variant	Exon 1 of 9	ENST00000392386.8	NP_004741.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CRLF1	ENST00000392386.8	c.31_53dupCAATCCGCGCGGCGGCCGCCGCC	p.Leu19AsnfsTer32	frameshift_variant	Exon 1 of 9	1	NM_004750.5	ENSP00000376188.2
CRLF1	ENST00000684169.1	c.31_53dupCAATCCGCGCGGCGGCCGCCGCC	p.Leu19AsnfsTer32	frameshift_variant	Exon 1 of 9			ENSP00000506849.1
CRLF1	ENST00000593286.1	n.367+749_367+771dupCAATCCGCGCGGCGGCCGCCGCC		intron_variant	Intron 1 of 1	4

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome AF: 0.00000105 AC: 1 AN: 952378 Hom.: 0 Cov.: 25 AF XY: 0.00 AC XY: 0 AN XY: 446588

African (AFR) AF: 0.00 AC: 0 AN: 18828

American (AMR) AF: 0.00 AC: 0 AN: 4044

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 9444

East Asian (EAS) AF: 0.00 AC: 0 AN: 15474

South Asian (SAS) AF: 0.00 AC: 0 AN: 18298

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10974

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2298

European-Non Finnish (NFE) AF: 0.00000119 AC: 1 AN: 838204

Other (OTH) AF: 0.00 AC: 0 AN: 34814

GnomAD4 genome Cov.: 29

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.067

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs137853929; hg19: chr19-18717413;