rs137853929

Variant names:

• chr19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C
• rs137853929
• NM_004750.5:c.31_53delCAATCCGCGCGGCGGCCGCCGCC

Your query was ambiguous. Multiple possible variants found:

• chr19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C
• chr19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-CGGCGGCGGCCGCCGCGCGGATTGGGCGGCGGCCGCCGCGCGGATTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_004750.5(CRLF1):​c.31_53delCAATCCGCGCGGCGGCCGCCGCC​(p.Gln11ValfsTer68) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000182 in 1,099,800 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 29)
  • Exomes 𝑓: 0.000018 (0 hom.)
• Consequence: CRLF1 NM_004750.5 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 2.48
• Publications: 1 publications found

Genes affected

CRLF1 (HGNC:2364): (cytokine receptor like factor 1) This gene encodes a member of the cytokine type I receptor family. The protein forms a secreted complex with cardiotrophin-like cytokine factor 1 and acts on cells expressing ciliary neurotrophic factor receptors. The complex can promote survival of neuronal cells. Mutations in this gene result in Crisponi syndrome and cold-induced sweating syndrome. [provided by RefSeq, Oct 2009]

CRLF1 Gene-Disease associations (from GenCC):

• Cold-induced sweating syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, Orphanet
• cold-induced sweating syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• idiopathic achalasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 24 pathogenic variants in the truncated region.
• PP5: Variant 19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C is Pathogenic according to our data. Variant chr19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 1322162.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004750.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CRLF1	NM_004750.5	MANE Select	c.31_53delCAATCCGCGCGGCGGCCGCCGCC	p.Gln11ValfsTer68	frameshift	Exon 1 of 9	NP_004741.1	O75462

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CRLF1	ENST00000392386.8	TSL:1 MANE Select	c.31_53delCAATCCGCGCGGCGGCCGCCGCC	p.Gln11ValfsTer68	frameshift	Exon 1 of 9	ENSP00000376188.2	O75462
	CRLF1	ENST00000928241.1		c.31_53delCAATCCGCGCGGCGGCCGCCGCC	p.Gln11ValfsTer68	frameshift	Exon 1 of 10	ENSP00000598300.1
	CRLF1	ENST00000971859.1		c.31_53delCAATCCGCGCGGCGGCCGCCGCC	p.Gln11ValfsTer68	frameshift	Exon 1 of 10	ENSP00000641918.1

Frequencies

GnomAD3 genomes AF: 0.0000203 AC: 3 AN: 147428 Hom.: 0 Cov.: 29

Gnomad AFR AF: 0.0000245

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000302

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000179 AC: 17 AN: 952372 Hom.: 0 AF XY: 0.0000313 AC XY: 14 AN XY: 446584

African (AFR) AF: 0.00 AC: 0 AN: 18828

American (AMR) AF: 0.00 AC: 0 AN: 4044

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 9444

East Asian (EAS) AF: 0.000323 AC: 5 AN: 15474

South Asian (SAS) AF: 0.00 AC: 0 AN: 18298

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10974

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2298

European-Non Finnish (NFE) AF: 0.0000143 AC: 12 AN: 838198

Other (OTH) AF: 0.00 AC: 0 AN: 34814

GnomAD4 genome AF: 0.0000203 AC: 3 AN: 147428 Hom.: 0 Cov.: 29 AF XY: 0.0000139 AC XY: 1 AN XY: 71832

African (AFR) AF: 0.0000245 AC: 1 AN: 40810

American (AMR) AF: 0.00 AC: 0 AN: 14904

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3412

East Asian (EAS) AF: 0.00 AC: 0 AN: 4968

South Asian (SAS) AF: 0.00 AC: 0 AN: 4800

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 8980

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 308

European-Non Finnish (NFE) AF: 0.0000302 AC: 2 AN: 66314

Other (OTH) AF: 0.00 AC: 0 AN: 2026

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000756

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	Cold-induced sweating syndrome 1 (2)
1	-	-	Cold-induced sweating syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.5
Mutation Taster		=19/181	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs137853929; hg19: chr19-18717413;