rs137853929

Variant names:

• chr19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C
• rs137853929
• NM_004750.5:c.31_53delCAATCCGCGCGGCGGCCGCCGCC

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_004750.5(CRLF1):​c.31_53delCAATCCGCGCGGCGGCCGCCGCC​(p.Gln11ValfsTer68) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000182 in 1,099,800 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 29)
  • Exomes 𝑓: 0.000018 (0 hom.)
• Consequence: CRLF1 NM_004750.5 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 2.48

Genes affected

CRLF1 (HGNC:2364): (cytokine receptor like factor 1) This gene encodes a member of the cytokine type I receptor family. The protein forms a secreted complex with cardiotrophin-like cytokine factor 1 and acts on cells expressing ciliary neurotrophic factor receptors. The complex can promote survival of neuronal cells. Mutations in this gene result in Crisponi syndrome and cold-induced sweating syndrome. [provided by RefSeq, Oct 2009]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 33 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C is Pathogenic according to our data. Variant chr19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C is described in ClinVar as [Pathogenic]. Clinvar id is 1322162.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr19-18606603-CGGCGGCGGCCGCCGCGCGGATTG-C is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CRLF1	NM_004750.5	c.31_53delCAATCCGCGCGGCGGCCGCCGCC	p.Gln11ValfsTer68	frameshift_variant	Exon 1 of 9	ENST00000392386.8	NP_004741.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CRLF1	ENST00000392386.8	c.31_53delCAATCCGCGCGGCGGCCGCCGCC	p.Gln11ValfsTer68	frameshift_variant	Exon 1 of 9	1	NM_004750.5	ENSP00000376188.2
CRLF1	ENST00000684169.1	c.31_53delCAATCCGCGCGGCGGCCGCCGCC	p.Gln11ValfsTer68	frameshift_variant	Exon 1 of 9			ENSP00000506849.1
CRLF1	ENST00000593286.1	n.367+749_367+771delCAATCCGCGCGGCGGCCGCCGCC		intron_variant	Intron 1 of 1	4

Frequencies

GnomAD3 genomes AF: 0.0000203 AC: 3 AN: 147428 Hom.: 0 Cov.: 29

Gnomad AFR AF: 0.0000245

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000302

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000179 AC: 17 AN: 952372 Hom.: 0 AF XY: 0.0000313 AC XY: 14 AN XY: 446584

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000323

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000143

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000203 AC: 3 AN: 147428 Hom.: 0 Cov.: 29 AF XY: 0.0000139 AC XY: 1 AN XY: 71832

Gnomad4 AFR AF: 0.0000245

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000302

Gnomad4 OTH AF: 0.00

Bravo AF: 0.00000756

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Cold-induced sweating syndrome Pathogenic:1

Jul 20, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: CRLF1 c.31_53del23 (p.Gln11ValfsX68) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Variants downstream of this position have been classified as pathogenic in ClinVar. The variant was absent in 25332 control chromosomes (gnomAD). c.31_53del23 has been reported in the literature in a homozygous individual affected with Cold-Induced Sweating Syndrome (example: Yamazaki_2010). The following publication has been ascertained in the context of this evaluation (PMID: 20186812). One submitter has cited clinical-significance assessments for this variant to ClinVar after 2014 and has classified the variant as pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Cold-induced sweating syndrome 1 Pathogenic:1

Jun 23, 2020

Revvity Omics, Revvity

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs137853929; hg19: chr19-18717413;