NM_004750.5:c.31_53dupCAATCCGCGCGGCGGCCGCCGCC

Variant names:

• chr19-18606603-C-CGGCGGCGGCCGCCGCGCGGATTG
• NM_004750.5:c.31_53dupCAATCCGCGCGGCGGCCGCCGCC

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_004750.5(CRLF1):​c.31_53dupCAATCCGCGCGGCGGCCGCCGCC​(p.Leu19AsnfsTer32) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000105 in 952,378 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 29)
  • Exomes 𝑓: 0.0000010 (0 hom.)
• Consequence: CRLF1 NM_004750.5 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: -0.0670

Genes affected

CRLF1 (HGNC:2364): (cytokine receptor like factor 1) This gene encodes a member of the cytokine type I receptor family. The protein forms a secreted complex with cardiotrophin-like cytokine factor 1 and acts on cells expressing ciliary neurotrophic factor receptors. The complex can promote survival of neuronal cells. Mutations in this gene result in Crisponi syndrome and cold-induced sweating syndrome. [provided by RefSeq, Oct 2009]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 33 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CRLF1	NM_004750.5	c.31_53dupCAATCCGCGCGGCGGCCGCCGCC	p.Leu19AsnfsTer32	frameshift_variant	Exon 1 of 9	ENST00000392386.8	NP_004741.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CRLF1	ENST00000392386.8	c.31_53dupCAATCCGCGCGGCGGCCGCCGCC	p.Leu19AsnfsTer32	frameshift_variant	Exon 1 of 9	1	NM_004750.5	ENSP00000376188.2
CRLF1	ENST00000684169.1	c.31_53dupCAATCCGCGCGGCGGCCGCCGCC	p.Leu19AsnfsTer32	frameshift_variant	Exon 1 of 9			ENSP00000506849.1
CRLF1	ENST00000593286.1	n.367+749_367+771dupCAATCCGCGCGGCGGCCGCCGCC		intron_variant	Intron 1 of 1	4

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD4 exome AF: 0.00000105 AC: 1 AN: 952378 Hom.: 0 Cov.: 25 AF XY: 0.00 AC XY: 0 AN XY: 446588

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000119

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 29

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-18717413;