19-38565660-TGGGGGCCCCTTCCGGCCCGAA-T
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000540.3(RYR1):c.13331_13351delGCCCCTTCCGGCCCGAAGGGG(p.Gly4444_Gly4450del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000081 in 1,234,646 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. G4444G) has been classified as Likely benign.
Frequency
Consequence
NM_000540.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- malignant hyperthermia, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp, Ambry Genetics
- congenital multicore myopathy with external ophthalmoplegiaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- RYR1-related myopathyInheritance: AR, AD Classification: DEFINITIVE Submitted by: ClinGen
- central core myopathyInheritance: AD, AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- King-Denborough syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- malignant hyperthermia of anesthesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- autosomal recessive centronuclear myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- benign Samaritan congenital myopathyInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- congenital myopathy with myasthenic-like onsetInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- lethal multiple pterygium syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| RYR1 | NM_000540.3 | c.13331_13351delGCCCCTTCCGGCCCGAAGGGG | p.Gly4444_Gly4450del | disruptive_inframe_deletion | Exon 91 of 106 | ENST00000359596.8 | NP_000531.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| RYR1 | ENST00000359596.8 | c.13331_13351delGCCCCTTCCGGCCCGAAGGGG | p.Gly4444_Gly4450del | disruptive_inframe_deletion | Exon 91 of 106 | 5 | NM_000540.3 | ENSP00000352608.2 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome AF: 8.10e-7 AC: 1AN: 1234646Hom.: 0 AF XY: 0.00000166 AC XY: 1AN XY: 601602 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 31
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at