19-53880584-C-CATTCATAGAGCCAGAGACACAGAGAGATTCAGAGTCAGAGAAACATAGAGATTCATAGAGCCAGAGACAAAGAGAGATTCAGAGTCAGAGAAACATAGAG

Position:

• chr19-53880584-C-CATTCATAGAGCCAGAGACACAGAGAGATTCAGAGTCAGAGAAACATAGAGATTCATAGAGCCAGAGACAAAGAGAGATTCAGAGTCAGAGAAACATAGAG

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The ENST00000479081.5(PRKCG):​c.-323+1273_-323+1274insAAGAGAGATTCAGAGTCAGAGAAACATAGAGATTCATAGAGCCAGAGACACAGAGAGATTCAGAGTCAGAGAAACATAGAGATTCATAGAGCCAGAGACA variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (no stars).

• Frequency:
  • Genomes: 𝑓 0.27 (3893 hom., cov: 44)
  • Failed GnomAD Quality Control
• Consequence: PRKCG ENST00000479081.5 intron
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 0.189

Genes affected

PRKCG (HGNC:9402): (protein kinase C gamma) Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
PRKCG	ENST00000479081.5	c.-323+1273_-323+1274insAAGAGAGATTCAGAGTCAGAGAAACATAGAGATTCATAGAGCCAGAGACACAGAGAGATTCAGAGTCAGAGAAACATAGAGATTCATAGAGCCAGAGACA		intron_variant		4

Frequencies

GnomAD3 genomes AF: 0.00 AC: 8754 AN: 32520 Hom.: 3900 Cov.: 44 FAILED QC

Gnomad AFR AF: 0.0570

Gnomad AMI AF: 0.304

Gnomad AMR AF: 0.382

Gnomad ASJ AF: 0.444

Gnomad EAS AF: 0.586

Gnomad SAS AF: 0.422

Gnomad FIN AF: 0.489

Gnomad MID AF: 0.341

Gnomad NFE AF: 0.451

Gnomad OTH AF: 0.321

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.269 AC: 8740 AN: 32550 Hom.: 3893 Cov.: 44 AF XY: 0.265 AC XY: 4196 AN XY: 15852

Gnomad4 AFR AF: 0.0569

Gnomad4 AMR AF: 0.381

Gnomad4 ASJ AF: 0.444

Gnomad4 EAS AF: 0.584

Gnomad4 SAS AF: 0.425

Gnomad4 FIN AF: 0.489

Gnomad4 NFE AF: 0.451

Gnomad4 OTH AF: 0.310

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: no assertion criteria provided

Submissions by phenotype

not provided Uncertain:1

Uncertain significance, no assertion criteria provided

clinical testing

Department of Pathology and Laboratory Medicine, Sinai Health System

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr19-54383838;