19-56814187-TTGGCTCAGCAGCCTCCACTTCTGGCTCAGCAGCCTCCACTTC-TTGGCTCAGCAGCCTCCACTTC

Variant names:

• chr19-56814187-TTGGCTCAGCAGCCTCCACTTC-T
• rs754092967
• NM_006210.3:c.4234_4254delGAAGTGGAGGCTGCTGAGCCA

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 2P and 1B. PM4 BP6

The NM_006210.3(PEG3):​c.4234_4254delGAAGTGGAGGCTGCTGAGCCA​(p.Glu1412_Pro1418del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000452 in 1,613,402 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.00040 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00046 (1 hom.)
• Consequence: PEG3 NM_006210.3 conservative_inframe_deletion
• Clinical Significance: Likely benign no assertion criteria provided B:1
• Conservation: PhyloP100: 0.988
• Publications: 0 publications found

Genes affected

PEG3 (HGNC:8826): (paternally expressed 3) In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2009]

ZIM2 (HGNC:12875): (zinc finger imprinted 2) In human, ZIM2 and PEG3 (GeneID:5178) are two distinct genes that share a set of 5' exons and have a common promoter, and both genes are paternally expressed. Alternative splicing events connect the shared exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. This is in contrast to mouse and cow, where ZIM2 and PEG3 genes do not share exons in common, and the imprinting status of ZIM2 is also not conserved amongst mammals. Additional 5' alternatively spliced transcripts encoding the same protein have been found for the human ZIM2 gene. [provided by RefSeq, Oct 2010]

ENSG00000286125 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_006210.3.
• BP6: Variant 19-56814187-TTGGCTCAGCAGCCTCCACTTC-T is Benign according to our data. Variant chr19-56814187-TTGGCTCAGCAGCCTCCACTTC-T is described in ClinVar as Likely_benign. ClinVar VariationId is 3055579.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006210.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEG3	NM_006210.3	MANE Select	c.4234_4254delGAAGTGGAGGCTGCTGAGCCA	p.Glu1412_Pro1418del	conservative_inframe_deletion	Exon 10 of 10	NP_006201.1	Q9GZU2-1
	ZIM2	NM_001387356.1	MANE Select	c.490+3538_490+3558delGAAGTGGAGGCTGCTGAGCCA		intron	N/A	NP_001374285.1	A0A8I5KWX0
	PEG3	NM_001369717.1		c.4240_4260delGAAGTGGAGGCTGCTGAGCCA	p.Glu1414_Pro1420del	conservative_inframe_deletion	Exon 9 of 9	NP_001356646.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PEG3	ENST00000326441.15	TSL:1 MANE Select	c.4234_4254delGAAGTGGAGGCTGCTGAGCCA	p.Glu1412_Pro1418del	conservative_inframe_deletion	Exon 10 of 10	ENSP00000326581.7	Q9GZU2-1
	PEG3	ENST00000599534.5	TSL:1	c.4234_4254delGAAGTGGAGGCTGCTGAGCCA	p.Glu1412_Pro1418del	conservative_inframe_deletion	Exon 7 of 7	ENSP00000472395.1	Q9GZU2-1
	PEG3	ENST00000599577.5	TSL:1	c.4234_4254delGAAGTGGAGGCTGCTGAGCCA	p.Glu1412_Pro1418del	conservative_inframe_deletion	Exon 9 of 9	ENSP00000469486.1	Q9GZU2-1

Frequencies

GnomAD3 genomes AF: 0.000395 AC: 60 AN: 151952 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000145

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000656

Gnomad ASJ AF: 0.00260

Gnomad EAS AF: 0.000386

Gnomad SAS AF: 0.000210

Gnomad FIN AF: 0.00170

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000338

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000515 AC: 129 AN: 250696 AF XY: 0.000516

Gnomad AFR exome AF: 0.000247

Gnomad AMR exome AF: 0.000116

Gnomad ASJ exome AF: 0.00209

Gnomad EAS exome AF: 0.000272

Gnomad FIN exome AF: 0.00162

Gnomad NFE exome AF: 0.000415

Gnomad OTH exome AF: 0.000982

GnomAD4 exome AF: 0.000458 AC: 669 AN: 1461330 Hom.: 1 AF XY: 0.000450 AC XY: 327 AN XY: 726914

African (AFR) AF: 0.000418 AC: 14 AN: 33478

American (AMR) AF: 0.000134 AC: 6 AN: 44698

Ashkenazi Jewish (ASJ) AF: 0.00203 AC: 53 AN: 26122

East Asian (EAS) AF: 0.000353 AC: 14 AN: 39692

South Asian (SAS) AF: 0.000174 AC: 15 AN: 86024

European-Finnish (FIN) AF: 0.00201 AC: 107 AN: 53336

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5766

European-Non Finnish (NFE) AF: 0.000379 AC: 421 AN: 1111850

Other (OTH) AF: 0.000646 AC: 39 AN: 60364

GnomAD4 genome AF: 0.000401 AC: 61 AN: 152072 Hom.: 0 Cov.: 32 AF XY: 0.000525 AC XY: 39 AN XY: 74334

African (AFR) AF: 0.000169 AC: 7 AN: 41502

American (AMR) AF: 0.0000655 AC: 1 AN: 15268

Ashkenazi Jewish (ASJ) AF: 0.00260 AC: 9 AN: 3464

East Asian (EAS) AF: 0.000387 AC: 2 AN: 5170

South Asian (SAS) AF: 0.000210 AC: 1 AN: 4770

European-Finnish (FIN) AF: 0.00170 AC: 18 AN: 10616

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.000338 AC: 23 AN: 67962

Other (OTH) AF: 0.00 AC: 0 AN: 2114

Alfa AF: 0.000860 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Likely benign

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	1	PEG3-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.99
Mutation Taster		=162/38	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs754092967; hg19: chr19-57325555;